1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
3 years ago
15

The percentage of money a credit card company charges customers who pay beck loans over time is called O A the credit score. O B

. the minimum monthly payment O c. the credit limit O D. the interest rate.​
Geography
2 answers:
Nina [5.8K]3 years ago
4 0

Answer:

c

Explanation:

padilas [110]3 years ago
3 0

Answer:

O D. the interest rate.​

Explanation:

Hope this helped!

You might be interested in
Question 5 (1 point)
yKpoI14uk [10]

Answer:

Author of Einstein biography i think

Explanation:

5 0
2 years ago
.....<br><br>;;.........................
damaskus [11]

Answer:

....

Explanation:

..........

6 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
The study of the Earth's atmosphere and its changing conditions is called
Step2247 [10]
Meteorology is the study of Earth's atmosphere and its changing conditions. Under this study includes the different changing weather conditions, its temperature and moisture patterns. Typhoons, tornadoes, snow hail, etc are being studied here. Meteorology because more or less meteors and atmosphere patterns are quietly related.
6 0
3 years ago
What do you mean by natural resources? Explain the types of natural resources on the basis of their distribution?​
lukranit [14]

Answer:

Natural resources are materials from the Earth that are used to support life and meet people's needs.

Explanation:

Ex : Oil, metals, stone, air, sunlight, soil water, Animals, birds, fish and plants etc...

use : used to make food, fuel and raw materials for the production of goods.

Natural resources are also categorized based on distribution:

* Ubiquitous resources are found everywhere (air, light, and water).

* Localized resources are found only in certain parts of the world (metal ores and geothermal power).

go for it!!!

i still remember it from my Middle school!

8 0
3 years ago
Other questions:
  • The process by which sheets of rock peel away from a large body of rock when pressure is removed ?
    11·1 answer
  • What is the vertical drop, or elevation drop, of a stream with headwaters at 1000 m and its mouth at 328 ft?
    8·1 answer
  • What is a consequence of increased livestock production?
    9·1 answer
  • The idea that one's environment is responsible for who people are and how
    12·1 answer
  • Which of the following definitions best sums up the study of geography?
    14·2 answers
  • Which form of government is practiced by both the united states and canada? A. Oligarchy b. Confederation c. Democracy d. Monarc
    11·2 answers
  • The major cultural division in Libya and the Maghreb is between _____.
    12·2 answers
  • 4 — A globalização pode aumentar a proliferação de doenças virais, devido ao aumento da circulação de pessoas. A pandemia do Cor
    11·1 answer
  • What is the Net Force?<br> 10 N<br> 10N
    8·1 answer
  • Que elementos conforman la cultura<br>plis ayuda se los pido​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!