Answer:
help provide better medical care and technology
Explanation:
- medical as in antibiotics, vaccines and medical tools.
- technology as in how much has it made our lives easier (information is easily accessible and connecting with our is faster)
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer:
The ecological footprint may be defined as the dependency of humans on nature. The ecological footprint support the economy or people of the country.
The main consequences that are related to the ecological footprints are the depletion and decrease of the natural resource. This might also cause the habitat loss of other species and the habitat fragmentation as well. The consequences also includes the increase in the pollution and natural calamities in an area.
