1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
givi [52]
2 years ago
10

Mitosis is a type of cell division. organize the images below to show the steps of mitosis.

Biology
1 answer:
barxatty [35]2 years ago
5 0

Answer:    

The correct order is F, E, C, G, H, A, D, and B (look at the image in the attached files)

Explanation:

  • <u>Interphase</u><u>:</u> Stages G1, S, and G2. At this point probably, the chromatin duplication has already occurred, but it is still lax or dispersed. It has not condensed yet. Two pairs of centrioles are outside the nucleus (FIGURE F)  
  • <u>Prophase</u>: Centrioles move forward to the opposite poles of the cell. Chromatin is condensed and individual chromosomes are now visible. The nuclear membrane breaks into many pieces. Spindle apparatus -microtubules- forms. (FIGURE E)
  • <u>Metaphase:</u> The polar and the kinetochore fibers drive each individual chromosome to the equatorial plane. This stage ends when all the chromosomes are completely arranged in the medial area.  (FIGURE C)
  • <u>Anaphase</u>: Sister chromatids separate and move to the opposite poles of the cells, driven by the microtubules. In each pole, there are a pair of centrioles (FIGURE G and H).
  • <u>Telophase</u>: The nuclear membrane rearranges. Each sister chromatid becomes now a new chromosome. There is a pair of centrioles outside each of the nuclei. (FIGURE A)
  • Cytokinesis occurs at the end of the cell division. The rest of the cell is divided into two new daughter cells. Each daughter cell is an identical copy of the other cell, with the exact same genetic material (FIGURE D).
  • Decondensation of the genetic material of each new cell (FIGURE B).

You might be interested in
Use biome in a sentence
garik1379 [7]
Plants such as the cactus reside in the desert biome.
8 0
3 years ago
Read 2 more answers
What are the monomers of proteins?
tensa zangetsu [6.8K]

Answer:

amino acids

Explanation:

4 0
1 year ago
Read 2 more answers
This is a volume of space that is empty of matter. Example: Sound cannot travel here.
aleksandr82 [10.1K]

Answer:

Vacuum

Explanation:

A vacuum is usually defined as a space in which there is an absence of matter. It can also be said that there is an extremely low amount of pressure due to which the particles present in it are not affected by any type of process that occurs in space. The value of pressure is lower than the value of normal atmospheric pressure.

For example, sound cannot travel in space because there is no medium such as water and air through which the sound waves can propagate.

8 0
3 years ago
What is the difference between self-love and selfishness according to Aristotle?
loris [4]
Aristotle finds the good and noble man to be selfish. But from his virtue and righteous behavior emerge gifts that his friends, his homeland, and his own community benefit from. He is a committed person who looks down upon material wealth, but enjoys the benefits of honor and dignity.
7 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • In nuclear fusion high pressure and temperature fuse two deuterium nuclei and transform into?
    5·2 answers
  • Dhehhebdhdudhebebehejehebebe
    13·2 answers
  • Which letter indicates tunnel-like junctions in the lateral membranes of adjacent epithelial cells?
    15·2 answers
  • Metabolic rate is _____.
    11·1 answer
  • In muscle cells, fermentation produces _____. In muscle cells, fermentation produces _____. carbon dioxide, ethanol, and NAD car
    6·1 answer
  • 2Which describes a function that is completed by both the
    11·1 answer
  • Cell ______, performs it’s functions, goes thorough ______________ to check mutations in DNA.
    15·1 answer
  • One way that air is cooled to the dew point to form clouds is when two different air masses meet.
    8·2 answers
  • How long does it take for them to move from Position A back to Position
    11·2 answers
  • Which of the following regarding puberty is FALSE? Select one: a. Early signs of puberty include breast budding in girls and gro
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!