Plants such as the cactus reside in the desert biome.
Answer:
Vacuum
Explanation:
A vacuum is usually defined as a space in which there is an absence of matter. It can also be said that there is an extremely low amount of pressure due to which the particles present in it are not affected by any type of process that occurs in space. The value of pressure is lower than the value of normal atmospheric pressure.
For example, sound cannot travel in space because there is no medium such as water and air through which the sound waves can propagate.
Aristotle finds the good and noble man to be selfish. But from his virtue and righteous behavior emerge gifts that his friends, his homeland, and his own community benefit from. He is a committed person who looks down upon material wealth, but enjoys the benefits of honor and dignity.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: