1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neporo4naja [7]
3 years ago
15

What is derived trait chart used for?

Biology
1 answer:
Minchanka [31]3 years ago
8 0

Answer:

Derived traits shared among the species or other groups in a dataset are key to helping us build trees. As shown above, shared derived traits tend to form nested patterns that provide information about when branching events occurred in the evolution of the species.

Explanation:

I hope this helps

You might be interested in
The ability of sperm cells to move along the ductus deferens is due to ________.
belka [17]
Peristaltic contractions
8 0
3 years ago
How is mitosis different from cancer cells
LiRa [457]
Cancer cells are created by mitosis. Mitosis is cell division. I don’t understand your question
3 0
3 years ago
A nursing team is short-staffed and extremely busy. an rn asks a nursing assistant to give a patient his afternoon medication. w
Irina18 [472]
A CNA, certified nursing assistant, can administer medication to patients. BUT this duty is subject to the level of experience and training of the CNA as well as the regulation of the state.

CNAs basically assist in the day-to-day care of patients like:
1) bathe and dressing
2) serving meals and helping them eat
3) taking their vital signs
4) and other basic necessities to ensure that the patient is comfortable and well cared for.
4 0
4 years ago
Can our cells carry out cellular respiration without oxygen? If so, how?
IRINA_888 [86]
Yes but just look it up also can someone answer my question? 10 points
4 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Other questions:
  • The effects of the sympathetic nervous system (sns) are divergent, meaning that a single stimulus can have an effect on a large
    10·1 answer
  • Which endocrine gland is responsible for the release of a hormone that stimulates T-cell development and proper immune response
    6·1 answer
  • How are cone cells adapted to carry out their function
    10·1 answer
  • Describe a predatory adaptation of the basking shark.
    10·1 answer
  • Do animals in the phylum Cnidaria have backbones
    7·2 answers
  • How does gel electrophoresis work?
    14·1 answer
  • Joe is trying to find out how solar energy can replace the functioning of certain industrial needs. With this research, which ph
    5·2 answers
  • Which of the following describes a cnidarian with a polyp body form?
    14·1 answer
  • Which do all cells need in order to function?<br> oxygen<br> watercarbon dioxide<br> offspring?
    9·1 answer
  • The word matrix can be used to describe things shaped In a pattern of lines and spaces. How does this relate to a mitochondrion?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!