1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tasya [4]
3 years ago
5

How does reflected light help you see objects in shadows?

Biology
1 answer:
dusya [7]3 years ago
3 0

Answer:

Rays of light reflect, or bounce off, objects just like a ball bounces on the ground. This reflection of light is what enables us to see everything around us. Light can reflect in different ways, changing the way objects look. Light reflects more off light-colored surfaces than dark-colored ones.

Explanation:

You might be interested in
Why are there different normal values for hemoglobin levels and rbc count in males and females?
alina1380 [7]
<span>Women's mean hemoglobin levels are about 12% less than the mean hemoglobin levels of men. This sex-related difference is observed in many species of animals, such as birds and reptiles. It's believed this difference exists in humans between males and females because men have larger bones, which means they would have more blood cells producing bone marrow. Additionally, men's kidneys have a larger diameter than women's kidneys, which would lead to increased red blood cell production.</span>
6 0
3 years ago
What variables should the scientists control in the experiment
Drupady [299]

Answer:

It's important for a scientist to try to hold all variables constant except for the independent variable. If a control variable changes during an experiment, it may invalidate the correlation between the dependent and independent variable. When possible, control variables should be identified, measured, and recorded.

6 0
3 years ago
Approximately what percent of the Earth’s surface is covered by ocean?
mestny [16]

The percent of the Earth's ocean is 70%.

5 0
3 years ago
Read 2 more answers
Which statement helps explain why humans have a highly developed forebrain and midbrain compared to other
GaryK [48]
I’d say, Humans have the ability for rational thought

Hope it works. Good luck :)
4 0
3 years ago
Read 2 more answers
Urgent needs an answer now!!!!!!!!!!!!!!!!!!!! Why does it take several redox reactions in a cell to make water from hydrogen an
ycow [4]

Answer:

hydrogen and oxygen combine explosively in a single raction

Explanation:

The reason is Molecules of hydrogen react with oxygen violently to break the initial molecular bonds and form new one between the atoms of the two elements. The reaction results into an explosive release of energy and the production of water because the products of the reaction are at a lower energy level

5 0
3 years ago
Other questions:
  • What can fish color tell us about human pigmentation? skin color is often one of the first traits people notice in each other. s
    13·1 answer
  • How are symbiotic relationships similar to and different from predator-prey interactions?
    8·1 answer
  • The end of existence of a group of organisms, caused by their inability to adapt to changing environmental conditions, is called
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Is it genetically the same or genetically different from the parents? Form an embryo that is genetically unique from the parents
    9·1 answer
  • Every plant has structures that function to help the plants survive. How does phototropism help a plant to survive.
    8·1 answer
  • 6. A skeptical attitude in science
    15·1 answer
  • Why do we compare the dermal tissue of plants to human skin? Explain your answer.
    7·1 answer
  • Squids, which are members of phylum mollusca, use an anatomical structure called a siphon for locomotion, feeding, respiration,
    7·1 answer
  • Which process is a characteristic of all living things and is responsible for differences within a population?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!