1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
7

True or False: the enzyme that scientists have found to break down the sugar chains of

Biology
1 answer:
olga_2 [115]3 years ago
4 0

Answer:

true

Explanation:

used my head

You might be interested in
A. Structure that organizes motion of chromosomes.
stealth61 [152]

Answer:

lol NO I MENA CENTROILE

Explanation:

3 0
3 years ago
Read 2 more answers
One advantage of paraphrasing a critic's comments is that the intensity of the attack may be reduced.
Ugo [173]
The statement above is TRUE.
Critics' comments are usually acidic and negative in tone. One advantage of paraphrasing such comment is that one has the power to make appropriate word choice that will reduce the attack intensity of such comments.
4 0
3 years ago
Koalas are marsupials that are found in eastern Australia. Although their ancestors lived mostly on the ground, modern koalas sp
forsale [732]
The right option is the second option, which states "<span>fur color that closely matches the eucalyptus bark color</span>". Change is in the fur color of Koala's to match the bark color of eucalyptus tree is a structural adaptation that fits them for their habitat as tree-dwellers.
6 0
3 years ago
Read 2 more answers
The formation of new organisms is called _____.
Gwar [14]
The answer is A, reproduction.
7 0
3 years ago
Read 2 more answers
Plantas de herbolaria mexicana que usamos para calmar problemas digestivos??
Igoryamba
Manzanilla, hinojo, menta puperita, melisa, regaliz, jengibre
8 0
3 years ago
Other questions:
  • What might the colonists have harvested in 1621?
    12·2 answers
  • Plant growers somtimes steralize their potting soil by heating it to high temperatures to kill pathogens that might be in the so
    10·1 answer
  • All but one of the girl's traits are determined by her chromosomes. that is
    14·2 answers
  • How does energy flow in a food chain or web? What happens as it moves up in trophic levels
    12·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Please help this is a 7th grade science problem
    5·1 answer
  • Do producers in an ecosystem transfer all their energy to first-level consumers?
    14·1 answer
  • I dONt WaNt TO `PLaY wItH a FisHEy On Me :)
    6·2 answers
  • In the name staphylococcus aureus, staphylococcus is the ?
    9·1 answer
  • This is the smallest mammal.​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!