1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
3 years ago
8

HELP URGENT!!!!!!!!!!!!!!​

Biology
1 answer:
pashok25 [27]3 years ago
4 0
If the paramecium was not able to contract its contractile vacuole, it would be in danger of bursting. The cell would not be able to hold too much water. This would happen faster if the paramecium was in water with a low salt concentration because there is more water and less salt, so the water would accumulate faster.
You might be interested in
Which is true about sex-linked traits?
Anna35 [415]

Answer:

I think the answer is B

Explanation:

6 0
2 years ago
Generalizations, explanations of natural phenomena, and additional hypotheses most often come about as a result of
natali 33 [55]

The explanations of natural phenomena, and additional hypothesis most often come about as a result of a scientific theory.

Explanation:

Scientific theory is a general explanation of natural phenomena developed through extensive and reproducible observations, more general and reliable than a hypothesis.

Then Every scientific theory starts as a hypothesis. A scientific hypothesis is a solution for an unexplained occurrence that does not fit into a currently accepted scientific theory. It must be based on careful rational examination of the facts.

7 0
2 years ago
What do rabbits like to eat?
Ainat [17]
Carrots i would like to beleive
4 0
2 years ago
The functional unit of the kidney is the .
katrin2010 [14]

Answer:

Nephron

Explanation:

4 0
3 years ago
Read 2 more answers
Describe the relationship among proteins, genes, and traits in living organisms.
Mila [183]
Is that they all have the same routine 
7 0
2 years ago
Other questions:
  • Why do substances and circumstances sometimes harm the fetus and sometimes have no impact?
    6·1 answer
  • After one frog's heart has been stimulated, an extract of fluid from that heart can make a second frog's heart beat faster. what
    9·1 answer
  • Evidence without_______
    9·1 answer
  • What function do cilia have in the respiratory system?​
    12·2 answers
  • A historian is awarded a grant to study the effects of industrial air pollution on sugarcane farms in Brazil. His research will
    11·1 answer
  • After surviving a bottleneck, a population recovers to the point where it consists of as many individuals as it did prior to the
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which genetically engineered crop had the highest percent of planted acres in 2014?
    9·1 answer
  • The organelles in a cell to the organs in your body.
    14·1 answer
  • If a cell is no longer able to differentiate into any type of tissue, it has become ________.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!