1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
3 years ago
15

Which statement(s) are true about mutations? (select all that apply)

Biology
2 answers:
makkiz [27]3 years ago
8 0
C. they are always heritable. b. they are inly heritable in gametes
Kazeer [188]3 years ago
8 0

Answer:

a, c, d,

Explanation:

they are more than genetic, and with that said, also cancels out b

You might be interested in
Why were different organisms
Andreyy89
To be honest I don’t really know
6 0
2 years ago
During respiration, most ATP is formed as a direct result of the net movement of potassium against a concentration gradient pota
Fantom [35]

Answer:

b. False

Explanation:

All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.

Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). These intermediary products are produced at the glycolysis and citric acid cycle stage.

Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.

Hence, during respiration, most ATP is formed as a direct result of the net movement of protons down a concentration gradient but not potassium against a concentration gradient potassium.

8 0
3 years ago
7.
MakcuM [25]

Answer:

C. fishes

Explanation:

3 0
3 years ago
Read 2 more answers
What is the first stage of the nuclear fuel cycle? WILL GIVE BRAINLY AND 22 POINTS Fuel production Uranium mining Reprocessing D
beks73 [17]

Answer is uranium mining.

3 0
3 years ago
Read 2 more answers
Compare all the organisms. What trend do you see? The proportions of DNA bases vary greatly among organisms. The proportions of
Paul [167]

The proportions of DNA bases are similar among all organisms.

4 0
4 years ago
Read 2 more answers
Other questions:
  • What is phototropism???​
    12·1 answer
  • _____ may have evolved as a mechanism that functions prevents individuals from being socially excluded from a group.
    11·1 answer
  • Mechanism of double fertilization
    12·1 answer
  • Choose the highest ranked category, which includes the greatest number of organisms.
    10·1 answer
  • Which type of fossil is an imprint made by an organism that was preserved in rock? A.cast fossil B.sedimentary fossil C.mold fos
    6·1 answer
  • What is the most common resources extracted from the ocean?
    14·1 answer
  • Suppose two people are exposed to equal doses of radiation (equal number of rads) inside their bodies. Suppose that the first pe
    10·2 answers
  • How do you think the high rates of HIV transmission in humans might be related to the length of time it takes for the virus to d
    5·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Tell me what are the goals of the c19 vaccine?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!