The conduction of nerve impulses relies upon the movement of positively-charged ions across the nerve cell membrane. The entry of sodium into the cell produces a wave of positive charge that travels down the length of an axon. Then chemicals called neurotransmitters are secreted out of the end of the axon onto the next nerve in the series (the postsynpatic nerve). This narrow space in between neurons is called the synapse. These neurotransmiiters released by the presynaptic nerve bind to receptors on the postsynaptic nerve. The binding of these receptors opens up channels in this second nerve's membrane that allow sodium ions to enter the nerve cell and initiate another wave of positive charge, and so on... The nerve signal can only move as fast as these ions and neurotransmitters can diffuse to generate this process.
<span>As a professional athlete repeats a given activity many times over, the nerve cells "upregulate" their receptors, meaning that they produce additional receptors to put in the membrane. This is just a natural reaction to the nerve being repeatedly stimulated in the same way over and over. When neurotransmitter is secreted from the presynaptic neuron, there are more receptors on the postsynaptic neuron for it to bind, more channels open up, more ions enter in a shorter time and build up positive charge to create the impulse faster, and so the overall effect is faster. </span>
<span>Additionally, there are sheaths of fatty tissue (called myelin) that insulate the charge in the neuron and allow it to be conducted faster. As people age, these sheaths can start to degrade, making the nerve cell more "leaky" and causing the impulse to be conducted more slowly. </span>
Answer:
Mutation, migration, genetic drift, and natural selection are all processes that can directly affect gene frequencies in a population.
Explanation:
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
The polar bear is an animal which is prevalent in the arctic region of the world which is characterized by very cold icy climate.
They adapt to these climatic conditions by maintaining a body temperature of 37°C through its thick fur and tough skin. It also has an insulating fat layer (adipose tissues) which is very thick.
This insulation helps in keeping the animal very warm in extreme temperatures.
