1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
3 years ago
6

If the Gazelle has 6000 calories of energy. How many calories of energy will be in the: a) cheetah b) The bush​

Biology
1 answer:
Vesna [10]3 years ago
7 0

Answer:

The bush has 60000 calories of energy while the cheetah will have 600 calories of energy

Explanation:

You might be interested in
Aerobic respiration is (1 point)
Anestetic [448]

<u>Answer</u>

Aerobic respiration is:

B) an efficient cellular respiration process that produces large amounts of energy.

8 0
2 years ago
Help me plz!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
skad [1K]

Answer:

D. population

Explanation:

7 0
2 years ago
Read 2 more answers
Darwin’s theory of evolutions unifies all of __________.
dezoksy [38]
Biology Biology Biology
I don’t what else to say
3 0
3 years ago
Read 2 more answers
Polymers are formed via dehydration reactions by molecules. Which of the following best describes a dehydration reaction?
netineya [11]

The correct answer is; "Assembling molecules in either hydroxyl or carboxyl functional groups"

Polymers are formed from monomers either by condensation or by addition of monomers.

A polymer is formed by the joining of one or more monomers. This can happen in either of the following ways;

  • condensation
  • addition

Condensation polymerization involves the loss of a small molecule. When the molecule that is lost is water, we can call it dehydration. Loss of molecules does not occur in addition polymerization.

The two monomer molecules that join to yield the polymer by dehydration must have H and OH moieties in suitable positions for dehydration to occur. A typical example is assembling molecules in either hydroxyl or carboxyl functional groups.

For more about condensation polymerization, see

brainly.com/question/18701826

7 0
3 years ago
The genotype is the genetic makeup of a
iogann1982 [59]
Falseeeeeeeeeeeeeeeeeeeeeeeeeee
4 0
3 years ago
Other questions:
  • Which characteristics do temperate continental slmiates have in common
    9·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which is not an example of a structural adaptation in plants?
    12·1 answer
  • In 1958, Meselson and Stahl conducted an experiment to determine which of the three proposed methods of DNA replication was corr
    8·1 answer
  • Whistling is considered bad luck among mariners because it challenges the wind. Where did this idea most likely come from?
    15·1 answer
  • Variables for how does adding fertilizer affect the growth of a plant?
    7·1 answer
  • The agricultural research facility during a research accidentally changed the DNA sequence of a wheat plant from GCCATGTT to GCG
    8·1 answer
  • Read each case file and fill in a cytogenetics report form for each case file.
    12·1 answer
  • Write a short note on tadpole and froglet.<br>please write in long​
    15·1 answer
  • Mutations are not always negative. Explain why this statement is true. Provide two reasons using examples to support your answer
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!