1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stealth61 [152]
3 years ago
15

Suppose you cut open a leaf in cross section and observed stomata

Biology
1 answer:
fomenos3 years ago
4 0
It’s monocot because dicots are found in the lower epidermis only
You might be interested in
For young and middle age adults, ________ is the single most important physical fitness component for enhancing and maintaining
liq [111]

Answer:

The answer is B.

Explanation:

For just about everyone but especially for young and middle aged adults, because of their expected level of physical fitness, the single most important physical fitness component is "Cardiorespiratory Endurance" which is the term to measure how one's lungs, muscles and heart keep up together with intense exercise over a long period of time. Cardiorespiratory Endurance can be increased by correct nutrition and regular work-out sessions.

I hope this answer helps.

4 0
4 years ago
Can i find dna in a dog or tree
jolli1 [7]

Answer:

A dog

Explanation:

8 0
4 years ago
Read 2 more answers
Which of the following processes results in the least amount of genetic
Artemon [7]

Answer:

segregation of alleles

Explanation:

because that the ways it suppose to be

5 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Which statement about energy is true ?
elixir [45]
D) Energy cannot be destroyed
5 0
4 years ago
Read 2 more answers
Other questions:
  • Wireshark's ability to capture traffic is greatly hampered by __________ because only packets destined to and from an attached s
    7·1 answer
  • Describe the role of phloem in photosynthesis
    5·1 answer
  • 9. Based on the diagram above, which of the labeled constituents carry oxygen from the lungs to other cells in the body?
    13·2 answers
  • The kinetic energy of a ball with a mass of 0.5 kg and a velocity of 10 m/s isJ.
    5·1 answer
  • What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG? A. CCTATGC B. TTGCGGC C. AACGTGC
    15·1 answer
  • What are the lines on a weather map that connect places of equal pressure called
    5·2 answers
  • Looking at a cell under a microscope, you note that it is prokaryote. How do you know?\
    15·2 answers
  • True or false if a plant grows toward the stimulus it shows a negative tropism
    11·1 answer
  • When a cat drops from a tree to the ground, the conversion of_________ A)gravitational potential energy to kinetic energy B)mech
    8·2 answers
  • Which best describes the daughter cells produced by mitosis
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!