1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
3 years ago
8

(Select all that apply.) Choose the parts of the body which incorporate cartilage.

Biology
2 answers:
saul85 [17]3 years ago
6 0

ears,nose,larynx,trachea

gogolik [260]3 years ago
3 0

Answer:

Nose , trachea , Larynx ears ,

Explanation:

Hope that helps

You might be interested in
A client reports an episode of losing control of urination when a bathroom wasnât close by. The client states, "Iâm worried this
nika2105 [10]

Answer: "Let's review your medication history and whether you consume bladder irritants."

Explanation:

Bladder irritants such as caffeine or alcohol can aggravate urge incontinence, which can occur if diuretics taken in the morning.

The nurse will begin by analysing those factors affecting the bladder irritants. Without further consideration the nurse should not dismiss this as an isolated case. This is too early to refer the person to the healthcare provider, or prescribe undergarments for incontinence.

Hence, the suitable statement by nurse is "Let's review your medication history and whether you consume bladder irritants."

6 0
3 years ago
50 pointss!! Name three things that threaten the water supply. How do you believe you can correct one of these problems in your
Alika [10]

Answer:

Microbes, salts, and pollution from agriculture and industry all contribute to the problem. Global warming will likely have major impacts on the world's freshwater resources.

Explanation:

Water source protection involves the protection of surface water sources and the protection of groundwater sources from contamination of any kind. Water source protection includes basic measures and rules such as the installation of a fence around the source or the banning of grazing animals in the surrounding area.

3 0
3 years ago
Which purposes do ngos serve with regard to human rights issues? select all that apply?
Yanka [14]
Mobilizing Public Opinion, Monitoring potential problems, reporting violations


8 0
3 years ago
Read 2 more answers
In a stream channel, what will be deposited first?
____ [38]
Heavy sedimentary items such as as rocks for example  <span />
5 0
3 years ago
Read 2 more answers
Composition of matter which depends on temperature.
Eduardwww [97]
I don't know the answer options, but it would probably either be phase of matter or physical change. 
8 0
3 years ago
Read 2 more answers
Other questions:
  • Researchers often find it more challenging to train dolphins rather than dogs even though dolphins are smarter. One of the reaso
    7·1 answer
  • 11. The highest level in the organizational hierarchy of the human body is the
    8·1 answer
  • What structures help fish navigate through the water
    5·1 answer
  • Where are the Falange located within the body
    13·1 answer
  • Some organisms obtain energy and nutrients from plants in an ecosystem. These organisms have energy stored in their bodies. What
    5·2 answers
  • Which organelles work together in converting the potential energy of organic compounds into a suitable form for media used by th
    7·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • A scientist sets up an experiment to see how colored lights affect the height of plant growth. He grows one group of plants in f
    5·1 answer
  • Can someone help me! plz
    8·1 answer
  • Which of the following are reactants of photosynthesis?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!