Answer:
-"Cell - some cells are meant to do a certain job then destroy self
-Digestion of surplus cells by their own lysosomal enzymes
Explanation:
Answer:
B. An egg cell and a sperm cell unite.
Explanation:
E Coli bacterium are about 2.0 micrometers in length and .25 to 1 micrometer in diameter. In comparison, a red blood cell is about 6 to 8 micrometers in diameter and a thickness that ranges from .8 to 1 micrometer in the center to 2 to 2.5 micrometers at the thickest point.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
a. Acetyl CoA carboxylase
Explanation:
Much of the fatty acids used by the body is supplied by the diet, excessive amounts of carbohydrates and protein obtained from the diet can be converted to fatty acids and stored as triglycerides. Fatty acid synthesis occurs mainly in the liver and mammary glands, and to a lesser extent in adipose tissue and kidney, the process incorporates acetyl CoA carbons into the forming fatty acid chain using ATP and NADPH.
The acetyl portion of acetyl CoA is transported to cytosol as citrate, produced by condensation of oxaloacetate and acetyl CoA, the first reaction of the citric acid cycle, this occurs when the concentration of mitochondrial citrate is high, observed when there is a high concentration of ATP and isocitrate dehydrogenase is inhibited. The increase of citrate and ATP favors the synthesis of fatty acids, since this pathway needs both. Acetyl CoA should be converted to malonyl CoA. Carboxylation is catalyzed by acetyl CoA carboxylase and requires ATP, this reaction is the regulated step in fatty acid synthesis: it is inactivated by products, malonyl CoA and palmitoyl CoA, and activated by citrate, another regulatory mechanism is reversible phosphorylation of enzyme, which makes it inactive due to the presence of adrenaline / glucagon
