1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mazyrski [523]
3 years ago
5

Find the value of x ?

Mathematics
1 answer:
Katyanochek1 [597]3 years ago
5 0

Answer:

Step-by-step explanation:

x = 1.5·42 = 63

You might be interested in
If a family of five spends, on the average, $125.75 on groceries each week how
Inga [223]

Answer:

$6539

Step-by-step explanation:

52x 125.75    (52 weeks in a year)

= 6539

5 0
4 years ago
What does 69/12<br> go into
laiz [17]
69 divided by 12. You divide 12 into the 69. 12 goes into 69 5.75 times.
6 0
3 years ago
A triangular prism has base edges 2 cm, 6 cm, and 7 cm long. Its lateral area is 330 cm2. What is the height of the prism? cm. T
Ostrovityanka [42]

9514 1404 393

Answer:

  22 cm

Step-by-step explanation:

The lateral area is the product of the perimeter and the height. The perimeter is the sum of side lengths.

  P = a+b+c = (2 +6 +7) cm = 15 cm

  LA = Ph

  330 cm^2 = (15 cm)h . . . fill in the known values

  h = (330 cm^2)/(15 cm) = 22 cm

The height of the prism is 22 cm.

3 0
3 years ago
HELP! ASAP! Am I correct!?!?
LenKa [72]
It isn't because, it isn't consistent, and it doesn't follow any of the other answer choices. :)

3 0
3 years ago
HELP!!!!! ILL give brainliest rn
valentinak56 [21]

Answer:

Construct one angle bisector of the triangle

Step-by-step explanation:

 

8 0
3 years ago
Other questions:
  • Write and solve an equation to answer the question,<br><br> "What number a is 25% of 64?"
    12·1 answer
  • Examine the diagram of circle V, where two chords, JK and LM, are equidistant from the center. If JK=4x+37, and LM=5(x+5), what
    14·1 answer
  • Please please answer this correctly
    7·1 answer
  • Heather has 6 dimes and 10 pennies. Jason has 3 quarters. Who has more money? Explain your answer.​
    10·2 answers
  • ∠A and \angle B∠B are supplementary angles. If m\angle A=(2x-14)^{\circ}∠A=(2x−14)
    10·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Tony earns $200 per week 5 dollars for every magazine subscription that she sells how much in dollars will she earn in a week in
    9·1 answer
  • Find the volume of this cylinder.<br> Give your answer to 1 decimal place.<br> 11 cm<br><br> 14 cm
    12·1 answer
  • 140,000 = 1.4 x 105<br> True<br> O False
    8·2 answers
  • Math help please I’ll give out brainliest!!!!!!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!