1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tasya [4]
3 years ago
11

What type of energy transformation takes place when a rose takes in energy from the soil and uses the energy to make its own foo

d?​
Biology
1 answer:
zalisa [80]3 years ago
8 0

Answer:

plants use photosynthesis to make food.

Explanation:

Photosynthesis takes place in the specific cells of plants known as chloroplasts, which are the cell type found in leaves. A single chloroplast is like a suitcase full of major photosynthesis materials. It has water-soaked from the root of the plant, atmospheric leaf absorbed carbon dioxide and chlorophyll in softened, labyrinthine organelles known as Thylakoids.

The true catalyst for photosynthesis is chlorophyll. This light-sensitive molecule is used to stimulate the process by cyanobacteria, plankton, and terrestrial plants.

The chlorophyll molecules are so awful for the green light to absorb that they reflect it like small mirrors that cause the majority of the leaves to look green. In the autumn we only look at these limitless colors of yellow and orange formed in carotenoid pigments after chlorophyll degradation.

You might be interested in
Which of these processes is most important for a person to replace worn-out body cells?
yulyashka [42]

Answer:

Mitosis

Explanation:

Mitosis produces new cells, and replaces cells that are old, lost or damaged for a person's body cells.

4 0
3 years ago
Name one strain of the bacteria that usually lives harmlessly in the digestive tracts of humans.
joja [24]

Eschecharia coli "E.Coli" is Bacterian strain which can survive within Digestive System of Human Body

It may also Cause Infection in your <Human> Gutt

7 0
4 years ago
Enzymes are _____. acids fats sugars proteins
jenyasd209 [6]
..........Proteins..........
5 0
4 years ago
Read 2 more answers
Which is not a reason to genetically modify an organism?
fenix001 [56]

Answer:

D- changing the dna of a crop plant to make it more susceptible to pest insects.

Explanation:

Genetically modified organism are those organisms in which the technology of genetic engineering is used to change their genetic makeup. Due to this change in genetic makeup allow the organisms to resist against disease causing microorganisms, pesticides and also increased the productivity of crops. In animals, genes are change to increase milk or meat production.

5 0
4 years ago
_________ are organisms that have had their genetic information modified in a way that does not occur naturally.
Elza [17]
Genetically modified organisms. (GMO)
4 0
3 years ago
Other questions:
  • Please help me,Thanks
    10·1 answer
  • How are genetic mutations passed from parent to offspring?
    5·2 answers
  • What is a "start codon"? What is the nitrogen base sequence for the start codon?
    8·1 answer
  • What component in our natural environment is not recyclable
    13·1 answer
  • HURRY
    12·2 answers
  • What does the color on the dna represent?
    7·1 answer
  • In which phase of mitosis are the chromosomes lined up in the middle of the cell?
    7·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Carbon is found in all known forms of life.which statement best describes why carbon
    6·1 answer
  • What does a food web show?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!