1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
3 years ago
7

Which area is indicated in the diagram below? (5 points)

Biology
2 answers:
slavikrds [6]3 years ago
6 0

Answer:

Oa

Explanation:

Thalamus is the middle

ss7ja [257]3 years ago
3 0

Answer:

Thalamus is the correct answer

Explanation:

I took the test and got it right

You might be interested in
Which part of a cell allows nutrients and other materials to enter or leave the cell
sweet [91]
I swear it's the cell membrane.. I'm not sure though
4 0
3 years ago
Read 2 more answers
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
How natural selection may lead to increases of species traits in a population
wolverine [178]

Answer:

Evolution reflects the adaptations of organisms to their changing environments and can result in altered genes, novel traits, and new species. One mechanism that drives evolution is natural selection, which is a process that increases the frequency of advantageous alleles in a population.

Explanation:

3 0
3 years ago
Most female frogs lays their eggs in water. Male frogs release their sperm into the water to fertalize the eggs this is an examp
Ludmilka [50]
I dont fully understand what the question is asking but this is an example of sexual reproduction.
7 0
4 years ago
Question 6
irakobra [83]

Answer:

True

Explanation:

The sinoatrial node is a small body of specialized muscle tissue in the wall of the right atrium of the heart that acts as a pacemaker by producing a contractile signal at regular intervals.

3 0
3 years ago
Other questions:
  • Which statement is best supported by the X-rays?
    8·2 answers
  • What do you know about a chemical compound by looking at its chemical formula?
    9·1 answer
  • What stage of cellular respiration is anaerobic? Glycolysis Calvin cycle Electron transport chain Krebs cycle
    10·2 answers
  • Milk production during breastfeeding is increased by the suckling of a newborn from his mother's nipple. this type of feedback m
    12·2 answers
  • Meningitis is the inflammation of the protective covering of the meninges. Which organs would be affected first by the condition
    5·2 answers
  • An elderly woman with multiple medical problems died from confired case of west nile virus. would an autopsy be preformed?
    11·1 answer
  • Which of the following structures would you not find in a prokaryotic cell
    7·1 answer
  • What changes can occur in an aquatic ecosystem as a result of neutrient loading?
    7·1 answer
  • Which is an example of electrical energy being converted or changed into light energy?
    5·1 answer
  • True or False: All species in an ecosystem are connected.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!