1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
strojnjashka [21]
3 years ago
10

A long note about Artificial Pacemaker (I WILL MARK YOU AS BRAINLIST PLS HELP)

Biology
1 answer:
natita [175]3 years ago
3 0

Answer:

A cardiac pacemaker is a medical device that generates electrical impulses delivered by electrodes to cause the heart muscle chamber to contract and therefore pump blood by doing so this device replaces and/or regulates the function of the electrical conduction system of the heart. The primary purpose of the pacemaker is to maintain an adequate heart rate, either because the heart’s natural pacemaker is not fast enough or because there is a block in the heart’s electrical conduction system.

Explanation:

Hope this helps you

You might be interested in
What is the most common method used to count a large species population
Gnoma [55]

Answer:

Ecologists

Explanation

often estimate the size and density of populations using quadrats and the mark-recapture method. A population can also be described in terms of the distribution, or dispersion, of the individuals that make it up. Individuals may be distributed in a uniform, random, or clumped pattern.

7 0
3 years ago
Read 2 more answers
What is the difference between surface tension and capillary action?
MakcuM [25]
Adhesion of water to the surface of a material will cause an upward force on the liquid. The surface tension acts to hold the surface intact. Capillary action occurs when the adhesion to the surface material is stronger than the cohesive forces between the water molecules.
5 0
3 years ago
Which theory suggests that speciation happens slowly through the accumulation of many small changes
amm1812
Answer: Gradualism (C)

Hope this helps
6 0
2 years ago
A flat area on a mountain is known as ?
stepan [7]
Hello! Mesa, (Portuguese and Spanish for table) is the American English Term for tableland, an elevated area of land with a flat top and sides that are usually steep cliffs. It takes its name from its characteristics table-top shape. It may asl be called a table hill, table-topped hill or table mountain. I hope this helps! :)
5 0
3 years ago
Which one of the following is a chemical reaction?
Ira Lisetskai [31]

Answer:b) digestion of food

Explanation:

4 0
3 years ago
Other questions:
  • What name is given to the monomers of proteins?
    15·2 answers
  • meteorologist want to design a system of instruments that will evaluate ocean currents, air temperatures, and wind speed in orde
    9·1 answer
  • What kinds of diseases can vaccinations prevent?
    11·1 answer
  • A research article undergoes peer review. The primary purpose of the peer review process is to
    6·1 answer
  • the appendages of cockroaches and turtles are modified for creeping movements,but their internal structures are completely diffe
    14·2 answers
  • NEED HELP QUICK!!
    10·1 answer
  • Define biodiversity and the importance of diversity in ecosystems. How could humans harm an ecosystem's biodiversity?
    7·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • *<br> What helps prevent bacteria from entering your lungs? *<br> HURRY!
    12·1 answer
  • PLS HELP ITS URGENT ITS DUE TODAY
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!