1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lemur [1.5K]
3 years ago
15

50 POINTS!!! PLZ HELP

Biology
2 answers:
ELEN [110]3 years ago
8 0

Answer:

i think it's A

Explanation:

Pathogens are known to interfere with the body functioning as well as the mind

expeople1 [14]3 years ago
6 0

Answer:

C.

Explanation:

So, a pathogen is something that causes disease, like a virus like the rhinovirus, which causes the common cold.

You might be interested in
The resting cell normally has a net negative charge with respect to the outside of the cell. what is this state called?
Zolol [24]
The answer is <span>polarized </span><span>state.</span>
5 0
3 years ago
ISP stands for____.<br>​
barxatty [35]
Internet service provider
5 0
3 years ago
Read 2 more answers
NO BOTS. please help will mark brainliest ​
Shalnov [3]

Answer:

TGCTCAGACT

ACGAGTCTGA

Explanation:

C is always paired with G

T is always paired with A

8 0
2 years ago
Read 2 more answers
imagine that you could treat chloroplats with an indiicator dye that turns red in acidic conditions, yellow in neutral ocndition
zmey [24]

The amount of light between points 1 and 2 is adequate for photosynthesis to occur at a faster rate than cellular respiration. Acidic conditions typically imply that the solution has an excessive concentration of H+, which makes the solution acidic. By dividing the reaction into half-reactions, the balancing process begins.

This indicates that more CO2 is being consumed than is being produced, which makes the problem more straightforward.

The signal will become purple as a result, from yellow. After point 2, light levels are low enough that cellular respiration outpaces photosynthesis, which results in more CO2 being generated than being absorbed and raising the pH of the solution. The indication will become yellow as a result, from purple.

An indicator dye called bromothymol blue (BMB) changes color from blue to yellow when acid is present. The pH of the solution decreases when carbon dioxide is introduced because it produces carbonic acid. When the pH is greater than 7.6, green, between 6.7 and 7.6, and yellow, less than 6, BMB is blue.

Learn more about to acidic conditions visit here;

brainly.com/question/14697894?

#SPJ4

3 0
1 year ago
How can speciation of plants benefit humans?
zepelin [54]
Speciation of plants can make us grows plants with a desired attribute.

This make the plants that we want could fulfill more of our needs, whether it's nutrients , material, or aesthetic purposes

hope this helps
4 0
3 years ago
Read 2 more answers
Other questions:
  • How much of the Earth’s water is usable as a freshwater resource?
    15·1 answer
  • If a cube measures 2.2cm, what is its volume?
    6·1 answer
  • "How many bubbles would both plants produce at the following depths: - 13 meters, 20 meters, 28 meters"
    13·1 answer
  • Prescribe how mountains change in abiotic conditions with an increase in elevations
    15·1 answer
  • Plant hormones can have different effects at different concentrations. this explains how ________.
    6·1 answer
  • What is the main source of carbon in an ecosystem?
    12·1 answer
  • To restore soil’s fertility, a farmer might plant legumes as part of a soil conservation technique called nutrient depletion. tr
    5·2 answers
  • Lions tend to prey on primary consumers like zebras and gazelles. if there were a sudden decline in a population of lions, which
    5·1 answer
  • I need help. Please helpppppppp
    7·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!