1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shepuryov [24]
3 years ago
11

_________ feed on dead matter, causing it to decay while ________ feed on already decaying matter.

Biology
2 answers:
DaniilM [7]3 years ago
7 0

Answer:

B) Saprobes, Detritivores

Explanation:

<em>Saprobes</em><em> </em>derive their nourishment from nonliving or decaying organic matter.

<em>Detritivores</em> feed on dead, organic material and play an important role in the breakdown of organic matter from decomposing animals and plants.

SVETLANKA909090 [29]3 years ago
5 0

Answer:

Decomposers, Consumers

Explanation:

You might be interested in
Cs,fcmv,slmdvlmvdvsf
Pavlova-9 [17]

Answer:

me too

Explanation:

4 0
3 years ago
Reefs grow best in _______.
il63 [147K]
<span>D is the correct answer. Coral reefs need sunlight to grow, so they grow best in shallow water (up to 50m deep) as this means sunlight can reach them. They require salt water to grow and warm temperatures of 20 - 32 degrees Celsius.</span>
4 0
3 years ago
Read 2 more answers
In a plant cell, DNA can be found in?
hoa [83]

Answer:

D. All of the above

Explanation:

Like all living organisms, plants use deoxyribonucleic acid (DNA) as their genetic material. The DNA in plant cells is found in the nucleus, the mitochondria and the chloroplasts. The latter two organelles are descendants of bacteria that were captured by a eukaryotic cell and have become endosymbionts.

8 0
3 years ago
Read 2 more answers
A researcher mixes M. tuberculosis with and without the rpoB mutation and adds the bacteria to cell cultures. Half the cell cult
kolezko [41]

Answer:

very few M. tuberculosis in the standard nutrient cell cultures carry the rpoB gene mutation, but almost all of the M. tuberculosis in the cell cultures with rifampin carry the rpoB mutation

4 0
2 years ago
The chemical reaction that takes place when a micro-organism turns one substance into another
zepelin [54]
This reaction is called a synthesis.
7 0
3 years ago
Other questions:
  • How are amino side chains usually classified? a. Small, Medium, or Large b. Straight, branches, or ringed c. Charged, polar, or
    12·1 answer
  • What property of light waves explains the appearance of the pencil under water?
    11·2 answers
  • What does the letter "A" stand? Acid Adenine Adrenaline Amorphous
    10·2 answers
  • Which of the processes are coupled (i.e. LINKED) in prokaryotic organisms but uncoupled (i.e. UNLINKED) in eukaryotic organisms?
    5·1 answer
  • Definition: This is an organism or cell with two sets of chromosomes
    7·1 answer
  • The big bang theory has finally answered one of the biggest questions of science—the origin of the universe is it true or false?
    15·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Please help me with this​
    14·2 answers
  • I need help. Due today.
    5·1 answer
  • How do you identify a interphase in mitosis​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!