1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanya [424]
3 years ago
13

Cholesterol can also accumulate in the walls of the coronary arteries.

Biology
2 answers:
tensa zangetsu [6.8K]3 years ago
6 0
A heart attack is most likely to occur
postnew [5]3 years ago
3 0
Cholesterol plaques can be the cause of heart disease. Plaques begin in artery walls and grow over years. The growth of cholesterol plaques slowly blocks blood flow in the arteries. Worse, a cholesterol plaque can rupture.
You might be interested in
the intake of food must be monitored to make sure that the cells in the body possess the essential nutrients to function​
azamat
Yes that is true it should be
4 0
4 years ago
Which of the following ideas is supported by Darwin's observation of local variation among tortoises in the Galapagos Islands A)
Hoochie [10]

Adaptation is supported by Darwin's observation of local variation among tortoises in the Galapagos Islands.

 

<span>In biology, an </span>adaptation, also called an adaptive trait, is a trait with a current functional role in the life of an organism that is maintained and evolved by means of natural selection. Adaptation<span> refers to both the current state of being </span>adapted<span> and to the dynamic evolutionary process that leads to the </span>adaptation.

 

The correct answer between all the choices given is the second choice or letter B. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

4 0
3 years ago
There are<br> 1,2,3 or 4 <br> basic wave forms.
Likurg_2 [28]

Answer:

4

Explanation:

i got it right

hope that helped ;)

6 0
3 years ago
Read 2 more answers
A plant can have green (G) or yellow (g) leaves. It can also have a long (K) or short (k) stem. A scientist is preparing a Punne
andrew11 [14]
Answer: <span>A. gk, gK
</span>
The scientist doing a dihybrid crossing using <span>plants with a genotype ggKk. To make the Punnet square, you need to understand how the gamete divided. The square should be
     K    k
g  gK   gk
g  gK   gk

The possible gamete for gg-Kk would be 
1. gK
2. gk
</span>
7 0
3 years ago
Read 2 more answers
Suppose a segment of mitochondrial DNA (mtDNA) is compared between two similar modern-day species. It is known that this segment
QveST [7]

Answer:

24 million years

Explanation:

A: GCACTAAGCATCGATTT

B: GCACCAGGCACTGGTTC

There are 6 base pair changes between species A and species B. Since we know the rate of change is 1 base pair every 4 million years, we know 6x 4 million is likely how long ago the species diverged. 6x 4 million = 24 million years

7 0
3 years ago
Other questions:
  • How could the movement of tectonic plates create another supercontient
    5·1 answer
  • Scientists want to determine how closely related chimpanzees are to humans. Which data would give the MOST accurate comparison?
    6·2 answers
  • "In the experimental setup below, which substance would be used to prove that the gas produced by the yeast in the vacuum bottle
    14·2 answers
  • You have been dispatched to a residence where a woman lacerated her arm after falling while holding a drinking glass. She inform
    6·1 answer
  • HALITOSIS IS ANOTHER WORD FOR DENTAL DECAY
    14·1 answer
  • The maps above show the arrangements of Earth's continents and oceans 65 million years ago and at present. Which of the followin
    15·2 answers
  • What percentage of people are likely to have mutations in their DNA?
    8·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Who discovered the cell fir the firat time ? What procedure did he follow?​
    13·1 answer
  • What are the contributions of each of these scientists to the cell theory? And how did that information contradict what was beli
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!