I think the answer would be yes, the nuclear membrane would be present. It is involved during the process of cytokinesis and is remain unchanged even the process is done. It is a very important part in order to have a healthy cell function.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
A theory in biology that includes one or both of the statements that the cell is the fundamental structural and functional unit of living matter and that the organism is composed of autonomous cells with its properties being the sum of those of its cells.
Explanation:
Although the inner leaflet of the gram-negative outer membrane is composed mainly of phospholipids, the outer leaflet of the outer membrane contains lipopolysaccharides.
Phospholipids are the most abundant component of the plasma membrane. The structure of phospholipids is composed of a backbone of glycerol containing two fatty acid chains attached to two hydroxyl groups and one phosphate group attached to the third hydroxyl group.
Lipopolysaccharides, also abbreviated as LPS, are the major component of bacterial cell wall. The role of LPS is to provide structural integrity and high permeability to the bacteria. LPS is a pyrogen and can be toxic to human body.
To know more about lipopolysaccharides, here
brainly.com/question/28238830
#SPJ4
Condensation occurs in the atmosphere, which is D. Think about water vapor. Since water vapor is part of the air, so that means that condensation occurs in the atmosphere.
Vocab:
Condensation - Is the change of the water vapor into the water, or overall the change of water from its gaseous form to liquid form.
Hope this helped!
