1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesya [120]
3 years ago
9

Viruses and bacteria can infect human cells. Bacteria are living organisms, while viruses are not. How do you think the treatmen

t for viral and bacterial illnesses differ? How do you think they affect healthy body cells? Explain your response.
Biology
1 answer:
Tatiana [17]3 years ago
4 0

Answer:

hope it helps

Explanation:

1) antibiotic drugs can kill bacteria however, they are not effective against viruses

2) some bacteria's help to digest foods and speed up enzyme reactions. Some bacteria cells destroy disease causing cells

You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
This is a type of non-Mendelian inheritance pattern that involves more than just the typical two alleles that usually code for a
Neko [114]
These are called multiple alleles.
4 0
3 years ago
Identify 2 biotic limiting factors. Select two that apply.
Vikki [24]
B and d is the answer
4 0
3 years ago
Read 2 more answers
Please help with my biology
Virty [35]

Answer:

Reptiles, like early dinosaurs.

6 0
3 years ago
Is the talc renewable?
Alekssandra [29.7K]

Answer:

no.its nonrenewable.

talc is nonrenewable.

thanks.

7 0
3 years ago
Other questions:
  • For natural selection to occur, there must be variety or diversity within a species.
    12·2 answers
  • PLZ HELP!!! I'm timed. I need answer as soon as possible. Will mark the brainliest if correct and ad a thanks with a rate of 5 t
    6·2 answers
  • NEED HELP HURRY<br>_____ immunity occurs when a person's immune system responds to an<br>antigen.
    10·1 answer
  • What is the answer i can’t figure this one out?
    11·1 answer
  • Describe two pieces of evidence that the earth is 4.4billion years old
    12·1 answer
  • What is meant by sex ​
    10·1 answer
  • PLEASE HELP ME QUICK!!!
    14·1 answer
  • For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to
    9·1 answer
  • A wealthy elderly couple dies together in an accident. A man comes forward, claiming that he is their long lost son and is entit
    10·1 answer
  • 2. Why is it important to have diversity within a population?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!