1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11Alexandr11 [23.1K]
3 years ago
8

HELPPPPPPP ITS URGENT!!

Biology
1 answer:
Cerrena [4.2K]3 years ago
3 0

Answer:

all

Explanation:

represents an observation is fact

offers an explanation is theory

defines a relationship is laws

hope it helps

You might be interested in
Organelle that manages or controls all the cell functions in a eukaryotic cell
Misha Larkins [42]

Answer:

Nucleus

Explanation:

The DNA of a eukaryotic cell is found in an internal compartment of the cell called the nucleus

3 0
3 years ago
Most living things need oxygen to survive. These two body systems bring oxygen into your body and then move to all your body par
Inga [223]

Answer:

Respiratory system and circulatory system.

The respiratory system allow living things to obtain oxygen from the air while the circulatory system allows oxygen to be carried around the body.

6 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What happens if you put a magnet next to iron
kenny6666 [7]
Depends in the weight of tge objects, but they will be drawb together
3 0
3 years ago
Read 2 more answers
Plants make their own food and are called producers. What do plants need to make their own food? A) soil, air and water B) soil,
enyata [817]

Answer:

D

Explanation:

A plant needs to use the energy from the sun to make glucose and other nutrients it needs. Air is needed for glycolysis and photosynthesis to occur. Water is needed by all living things to stay alive.  

5 0
3 years ago
Read 2 more answers
Other questions:
  • How does mitosis in plant cells differ from that in animal cells? A. Plant cells lack spindle fibers. B. Plant cells lack centro
    8·2 answers
  • Mammals that live in the Arctic Ocean have a large amount of blubber, which is a fatty tissue just beneath the skin. Which state
    13·2 answers
  • In scientific method, a part of the experiment is repeated many times in order to reduce randomness or error. These repetitions
    11·1 answer
  • Anna garcia choose one structure from any of the body systems. for your chosen structure, suggest the effect that the malfunctio
    13·1 answer
  • Photosynthetic organisms, such as plants and algae, depend on the availability of two important inorganic nutrients, _____ and _
    11·1 answer
  • Where are primary consumers found?
    7·2 answers
  • Plz Answer! Which of the following describes a relationship of commensalism?
    14·2 answers
  • Which best describes how air moves during convection?
    8·2 answers
  • When was Escherichia first isolated and characterized?
    15·1 answer
  • Help plz!! :
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!