1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
12

List three structures of nerve cells that are found in animal cells. (Science)

Biology
1 answer:
Over [174]3 years ago
8 0

Answer:

 its cell body, dendrites, and axon

You might be interested in
If a protein is heated to a high temperature, what do you predict would be the most likely effect on the protein?
gavmur [86]
The protein would come denatured, losing its shape , and would not be able to function properly 
4 0
3 years ago
Read 2 more answers
Which of the following is an accurate statement of the relationships within this cladogram?
quester [9]

B. Clade 1 is ancestral to all the other clades

8 0
3 years ago
Alonso is studying for a test. In order to help understand the term cardioesophageal sphincter, he recalls that cardio
Ipatiy [6.2K]

Answer: C) breaking down terminology

Explanation:

6 0
3 years ago
What is the correct way to analyze a term that means "softening of the cartilage"?
Ber [7]

Chondromalacia is the synonymous of the cartilage softening (chondro = cartilage, malacia = soft). It's a pathology of softening affecting the joints and more particularly those of the knee (kneecap and femur).

This anomaly can be observed in several circumstances:

• the first is that of direct trauma. It is the cartilaginous lesion occurring before the fracture (fissure) of the cartilage.

• the second is that of common osteoarthritis. It is highly likely that the first stage of osteoarthritis begins with edema (swelling of the cartilage or closed chondropathy) that makes the cartilage less resistant and more vulnerable; this soft cartilage can then crack on its surface (open chondropathy) and these cracks will be more difficult to heal.

8 0
3 years ago
List all the subsets of each set.<br><br> {dog, cat, fish}
Burka [1]
Subsets of {dog, cat, fish} are Ф, {dog}, {cat}, {fish}, {dog, cat}, {dog, fish}, {cat, fish}, {dog, cat, fish}.
7 0
2 years ago
Read 2 more answers
Other questions:
  • If a single mutation turns off the growth of some pairs of legs within an organism, what's most likely affected
    5·1 answer
  • Does granite form crystals
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • This is rivalry or competition between individuals of different species within a specific habitat.
    8·1 answer
  • What is the largest latitude one can reach
    10·1 answer
  • Which two classification levels do we use in binomial nomenclature?
    12·1 answer
  • It essential that the human body maintain adequate levels of calcium at all times. A drop In levels stimulates the parathyroid g
    7·1 answer
  • What's Transpiration ?​
    6·1 answer
  • How can such a small tank contain enough helium to fill so many balloons
    8·1 answer
  • For you who who like brainly
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!