1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jarptica [38.1K]
3 years ago
6

HELP!!!!!!!!!!!!!!!!!!!!!!!!!

Biology
2 answers:
kompoz [17]3 years ago
4 0
A) 1. Growth and Maintenance
2. Causes bio-chemical reactions
3. Acts as a messenger
4. Provides structure

B) 1. Lean meats
2. Dairy products
madreJ [45]3 years ago
3 0
4-Growth, maintenance, balance fluids, maintain proper hp

2-Actin, collagen
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which of the following is an example of convection? A.) a hot oven warming the air around it B.) hot air rising and cooler air f
Snezhnost [94]

D.hot air rising and cooler air falling. A is example of radiation or conduction. B is example of radiation. C is example of conduction. D is example of convection

5 0
3 years ago
Read 2 more answers
Which of the statements describes characteristics of eukaryotic cells but not of prokaryotic cells? O two or more linear chromos
gtnhenbr [62]

O relatively large genome, dynamic cytoskeleton, compartmentalized metabolic processes

Explanation:

Eukaryotic cells also contain other membrane-bound organelles such as mitochondria and the Golgi apparatus, and in addition, some cells of plants and algae contain chloroplasts. Unlike unicellular archaea and bacteria, eukaryotes may also be multicellular and include organisms consisting of many cell types forming different kinds of tissue. 

DNA is located in the nucleus, the mitochondria and the chloroplasts (occuring only in plants and some protists). The nucleus contains most DNA. It is present in this compartment in the form of linear chromosomes that together constitute the genome.

Eukaryotic cells generally use aerobic respiration – requiring oxygen – to produce usable energy called ATP from glucose molecules. ... Prokaryotic cells, on the other hand, tend to use anaerobic respiration – not requiring oxygen.

3 0
3 years ago
20<br> Compared with mitosis, the process of meiosis results in daughter cells<br> that are-*
USPshnik [31]

Answer:

D haploid (n) with a smaller number of chromosomes than the parent cells

Explanation:

meiosis results in gametes which have half the number of chromosomes and are therefore diploid because they have one set only. that is because later, the two cells with half the chromosomes (egg and sperm) join together to make a diploid cell

8 0
2 years ago
Histological identification of the ____________ of the adrenal cortex is fairly easy as the cells are plump with lipids and arra
Dvinal [7]

Answer:

Zona fasiculata.

Explanation:

Zona fasiculata is present in the middle of the adrenal cortex lies beneath the zona glomerulosa. This layer produces the glucocorticoids especially cortisol that regulates the glucose metabolism.

The zona fasiculata layer can be easily determined historically. This layer of adrenal cortex contains the long cords or column cells and the cells are plump with liquid.

Thus, the correct answer is option (b).

8 0
2 years ago
Other questions:
  • List three elements that carbon atoms bond with to form some of the compounds that are found in durian fruit.
    5·2 answers
  • If color blindness is an X-linked recessive trait, what genotype in a father and a mother would be predicted to produce a 1:1 ra
    13·1 answer
  • Describe what would likely happen to an ecosystem if either it’s producers or decomposers were removed. Be sure to explain your
    12·1 answer
  • For most women, the American Academy of Pediatrics recommends exclusive breast-feeding for the first 6 months of the baby’s life
    7·1 answer
  • Why do arteries need to be thick, muscular, and elastic?
    14·2 answers
  • What would happen to the planets if the Sun no long had gravity?
    8·2 answers
  • A scientist has 400 grams of a radioactive substance with a half-life of one year. The amount of the substance that the scientis
    12·2 answers
  • Which of the following are matched correctly? (choose all that
    8·1 answer
  • Provide means of transportation
    10·2 answers
  • Is interest in renewable resources new to the United States? Explain your answer.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!