1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Usimov [2.4K]
2 years ago
12

What are three ways that climate change is affecting ecosystems in the oceans?

Biology
1 answer:
lukranit [14]2 years ago
7 0

Answer:

coral beaching

drowning wetlands

fish migration

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
When a plant encounters stressful hot and dry conditions, the?
Tasya [4]
The plant goes into shock
7 0
3 years ago
B. nuclear______occurs in star's<br> core that combines elements to make<br> BIGGER elements.
inysia [295]

Answer:

nuclear <u>fussion</u> occurs in star's core that combines elements to make BIGGER elements.

Explanation:

Hope this helps :)

4 0
2 years ago
In a healthy human, the typical life span of a red blood cell is
iogann1982 [59]
Human red blood cells are formed mainly in the bone marrow and are believed to have an average life span of approximately 120 days<span>.</span>
8 0
3 years ago
Homologous structures are defined as anatomical structures originating from the
ValentinkaMS [17]

Explanation:

An example of homologous structures in vertebrates is

where the wings of bats, front flippers of whales, and forelegs of four-legged vertebrates like dogs and crocodiles are all derived from the same ancestral tetrapod structure.

7 0
3 years ago
Other questions:
  • In one to two sentences, evaluate why some scientists think the winter weather near the Western European coast might change in t
    15·1 answer
  • What is the most likely depositional environment for an evaporite unit?
    12·1 answer
  • Where on earth is the greatest amount of oxygen stored?
    11·1 answer
  • I NEED THIS ANSWERED FAST!!! Which of the following is an example of direct use?
    12·2 answers
  • A single lunar cycle lasts a <br><br>1.day<br>2.week<br>3.month<br>4.year
    6·1 answer
  • A planet that has a solid, rocky surface. Terrestrial planets tend to be smaller than gas giants.
    14·1 answer
  • Which of these species typically has a mortality rate that remains fairly constant over an individual's life span?A. HumansB. Oy
    9·1 answer
  • How is hydrogen different from all the other elements?
    12·2 answers
  • A complete carbohydrate is a macromolecule is it a large or small molecule
    11·1 answer
  • Are mammals vertebrates or invertebrates?<br> A. Vertebrates<br> B. Invertebrates
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!