1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marta_Voda [28]
2 years ago
11

Como separas una mezcla de azufre y limaduras de hierro

Biology
1 answer:
Marta_Voda [28]2 years ago
3 0
No hablo espanoł amigo
You might be interested in
CER:Are viruses living thing?​
Grace [21]

Answer:

yes, viruses count as bacteria, and bacteria are living.

hope this helps :D

7 0
3 years ago
Read 2 more answers
Jonathan is learning about water conservation. He learns that the average household in the United States uses 293 gallons of wat
sashaice [31]
C is the correct answer


4 0
3 years ago
Read 2 more answers
What is mitosis? help pls !!
Pavlova-9 [17]

Answer:

<em>Mitosis </em><em>is </em><em>a </em><em>type</em><em> of</em><em> </em><em>cell </em><em>division </em><em>that </em><em>results</em><em> </em><em>in </em><em>two </em><em>daughter</em><em> </em><em>cells </em><em>each </em><em>having</em><em> </em><em>the </em><em>same </em><em>kind</em><em> </em><em>of </em><em>chromosomes</em><em> </em><em>as </em><em>the </em><em>parent</em><em> </em><em>cell.</em><em>.</em><em>it </em><em>mostly</em><em> </em><em>occurs</em><em> </em><em>in </em><em>eukaryotic </em><em>cells</em><em>.</em>

<em>I </em><em>hope </em><em>this </em><em>helps</em>

3 0
3 years ago
Read 2 more answers
A combined sewer system carried___ to a sewage treatment plant. A. Household waste water B. Rain water C. Lawn run of D. All the
Inessa [10]

Answer:

The answer is D.

Explanation:

Sewers are connected to households and usually roads. When rain comes down, it goes down the drain in the road which leads to the sewers. The same thing happens with the answer C. A, household waste water, is connected to the sewers as well. So, since all three of these are correct, you would choose D.

Hope this helps.

3 0
3 years ago
Select the correct answer.
exis [7]

Compound microscope is being used..

Hope it helped you... pls mark brainliest also

8 0
2 years ago
Read 2 more answers
Other questions:
  • Permanent, heritable changes in genetic information (dna) are called
    7·1 answer
  • The three types of ocean floor sediments are terrigenous, biogenic, and _____.
    12·1 answer
  • Are there more than one air mass if so.PLZ help
    6·2 answers
  • I need help I don’t know how to arrange them right what’s the answer? I couldn’t fit all the boxes but the second to last one sa
    12·1 answer
  • The largest molecules in organisms are _____.
    5·1 answer
  • Which conclusion can be supported by the fact that explorers introduced dogs and horses in Florida?
    8·1 answer
  • How can gentically modified salmon effect society
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Two ways that people can reduce the impacts of landslides
    9·2 answers
  • For blood to be separated into its primary visible components of plasma and red blood cells, it must be spun around in a machine
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!