1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
3 years ago
15

What is the term for changes that occur in most members

Biology
1 answer:
Anna71 [15]3 years ago
5 0

Answer:

nonnormative changes

Explanation:

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which list correctly alligns the levels of organisms from the least to the most complex​
zepelin [54]

Answer:

cell > tissue> organ> system

Explanation:

6 0
2 years ago
What is another word for cytosol
snow_tiger [21]
Another word for cytosol  is cytoplasm.
4 0
3 years ago
A major volcanic belt known as the _____ circles the Pacific Ocean.
frutty [35]
A. Ring of fire I hope this hoped u today
5 0
3 years ago
Along with the spin of earth what causes it magnetic field??
IRINA_888 [86]

It was believed that the magnetic field to be generated deep down in the Earth's core. But the truth is the flow of liquid iron generates electric currents, which produces magnetic fields.

But the truth is no one really knows for certain so the only thing we know is that the spin of the earth is the cause of its magnetic field

Hope this helped :)

Have a great day

7 0
3 years ago
Read 2 more answers
Other questions:
  • What could happen to a Galapagos penguin who was suddenly moved to Antarctica?
    15·1 answer
  • Some mutations always occur from generation to generation but most mutations to not persisting overtime in the gene pool which m
    14·1 answer
  • What does an animal do when it respires
    9·1 answer
  • My parents are too hard on me to get good grades and it stresses me out. Help!
    6·2 answers
  • At which stage would centromeres of sister chromatids Disjoin and chromatids separate?
    10·1 answer
  • Era
    15·2 answers
  • When a sound source is moving away from you, the pitch becomes lower, indicating a decrease in perceived frequency. If a light s
    10·2 answers
  • Oping
    10·1 answer
  • Pick any alternative energy, that you believe is best suited to use while saving the environment and discuss. (3-6) sentences.
    6·1 answer
  • A group of scientists discovered a new organism that is composed of many cells, gets its nutrition from decaying organisms, and
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!