1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentina_108 [34]
3 years ago
11

Which of the following describes movement of molecules into a cell through active transport?

Biology
1 answer:
andreev551 [17]3 years ago
8 0
C.. i think DDFJYEWGKO
You might be interested in
What evidence shows that biological molecules on earth form naturally?
Anestetic [448]

Explanation:

La siguiente entrada tiene como objetivo realizar una breve explicación sobre las moléculas biológicas  lipídos y carbohidratos, las cuales son muy diversas ya que están formadas por carbono, lo cual hace que puedan formar muchos tipos de enlaces. Esta capacidad permite que las moléculas orgánicas  adopten muchas formas complejas, como son las cadenas, las ramificaciones y los anillos.

Las moléculas biológicas son grandes polímeros que sintetizas para poder enlazarse con otras subunidades mucho mas pequeñas conocidos como monómeros. Las cadenas de subunidades estan unidas por enlaces covalentes los cuales se forman por deshidratación, estas cadenas pueden romperse por hidrólisis. La moléculas biologicas más importantes son los carbohidratos, lípidos, proteínas y ácidos nucleicos.

4 0
2 years ago
What was the first dino discovered
Rudiy27

Answer:

t_rex

Explanation:

because its the oldest

4 0
3 years ago
Read 2 more answers
At what stage of human development would you expect to first see a beating heart?
IRINA_888 [86]

at what stage of human development wuold you exept to first see abeating heart? <u>the</u><u> </u><u>answ</u><u>er</u><u> is</u><u> </u><u>ç</u>

6 0
3 years ago
Read 2 more answers
Greenhouse gases are essential to support life on earth. Please select the best answer from the choices provided
ddd [48]
True. Greenhouse gases are composed of many molecular components that provide and are necessary for life to still exist on earth. For example, the carbon dioxide and the others alike. However, when these exceed the necessary level and amount in the atmosphere, they cause tremendous increase in temperature. 
7 0
3 years ago
Read 2 more answers
Describe major trends in the evolution of life on Earth seen over geologic time supported by fossils
Aleks [24]

Answer:

Fossils are the preserved remains or traces of animals, plants, and other organisms from the past. Fossils are important evidence for evolution because they show that life on earth was once different from life found on earth today

Explanation:

8 0
2 years ago
Other questions:
  • Are mannose and galactose diastereoisomers? consider only d-sugars.
    12·1 answer
  • Why are some of Carl Linnaeus’s classifications of organisms incorrect?
    13·1 answer
  • What is the subunit of proteins
    11·1 answer
  • Am I right? I will mark a brainliest! :) there is a picture!
    9·1 answer
  • Scientists can use genetic information to identify people because it is unique to each person. Which specific characteristic is
    11·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which distance is the greatest
    13·1 answer
  •   The water table is the
    9·1 answer
  • During a laboratory experiment, you discover that an enzyme-catalyzed reaction has a △G of -20 kcal/mol. If you double the amoun
    15·1 answer
  • Select the correct answer from each drop-down menu. Plants use sunlight to convert nutrients into energy. What form of energy tr
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!