1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreev551 [17]
3 years ago
12

What is the scientific way of planting? Why is it important?

Chemistry
1 answer:
Marat540 [252]3 years ago
8 0

Answer:

When seeds begin to grow, or germinate, they develop roots to help them develop into plants. Food – A plant makes its own food through a process called photosynthesis. In photosynthesis, a plant uses the energy from sunlight to change carbon dioxide (from the air) and water (from the soil) into sugars called glucose.

You might be interested in
The volume and amount of gas are constant in a tire. The initial pressure and temperature are 1.82 atm and 293 K. At what temper
vladimir1956 [14]

Answer:

When the pressure increases to 2.35 atm, the temperature will increase to 378 K

Explanation:

Step 1: Data given

The initial pressure = 1.82 atm

The initial temperature = 293 K

The pressure will be increased to 2.35 atm

Step 2: Calculate the new temperature

P1/T1 = P2/T2

⇒with P1 = the initial pressure = 1.82 atm

⇒with T1 = the initial temperature = 293 K

⇒with P2 = the increased pressure = 2.35 atm

⇒with T2 = the new temperature = TO BE DETERMINED

1.82atm / 293 K = 2.35 atm / T2

T2 = 2.35 atm / (1.82 atm/293 K)

T2 = 2.35 / 0.0062116

T2 = 378 K

When the pressure increases to 2.35 atm, the temperature will increase to 378 K

4 0
3 years ago
A company's managers ask, "Should we increase the size of our Bluetooth wireless speaker and sell it at a higher cost?" Never pr
Ivahew [28]

Complete Question

Identify whether the following activity on the table shown on the first uploaded image are examples of business level or  corporate level strategy

Answer:

The solution to this is shown on the second uploaded image

Explanation:

The explanation is shown on the third and fourth  uploaded image

5 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Calculate the wavelength (in nm) of the blue light emitted by a mercury lamp with a frequency of 6.32 × 1014 Hz.
tester [92]

Answer:

474 nm or 4.74 x 10^2 nm

Explanation:

c = λv

c (speed of light) = 2.998 x 10^8 m/s

λ = ?

v = 6.32 × 1014 Hz = 6.32 × 1014 1/s

2.998 x 10^8 m/s = (λ)(6.32 × 10^14 1/s)

λ = (2.998 x 10^8 m/s) / (6.32 × 10^14 1/s)

λ = 4.74 x 10^-7 m

λ = 4.74 x 10^-7 m x (1 x 10^9 nm/1 m) = 474 nm

7 0
2 years ago
What common household element can, over time, reduce airflow, insulate components, reduce heat exchange or even cause the system
lina2011 [118]

Answer:

The correct answer is Dust

Explanation

Dust is a dry dirt in powder form usually found on surfaces of items in a building, it comprises of very small particles of soil, sand and sometimes includes toxic substances, skin cells,bacteria, soil particles, particles of clothing material, tiny pieces of dead insects and pollen

4 0
3 years ago
Read 2 more answers
Other questions:
  • Suppose 1.65 moles of C₆H₆ react with excess oxygen to produce carbon dioxide and water.
    6·2 answers
  • What is the chemical formula for flint
    11·1 answer
  • Is a formation of a limestone cave a physical change?
    10·1 answer
  • What term refers to columns of elements?
    14·1 answer
  • What does centripetal force mean?
    8·1 answer
  • How to find a girl frind at age 70
    12·2 answers
  • If you have a dozen pennies and a dozen quarters, how many coins do you have?
    13·1 answer
  • Write a balanced chemical equation depicting the formation of one mole of H2O2(g) from its elements in their standard states.
    10·1 answer
  • PLSS HELP I GIVE BRAINLIEST
    8·1 answer
  • In scientific notation, the number 0.00262 is expressed as
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!