1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
7

Help Please!!!

Biology
1 answer:
Nimfa-mama [501]3 years ago
4 0

Answer:

The cosmic microwave background (CMB) is thought to be leftover radiation from the Big Bang, or the time when the universe began. As the theory goes, when the universe was born it underwent a rapid inflation and expansion. ... The CMB represents the heat left over from the Big Bang.

You might be interested in
Describe two typical applications for each of the following types of microscope
Veseljchak [2.6K]
A.Transmission electron microscopes are a versatile tool for many fields, including medicine, biology, nanotechnology, metallurgy, forensics, electronics, material science, and much more. A biologist might use a TEM to look at the internal structure of a cell.

b. Industries including microelectronics, semiconductors, medical devices, general manufacturing, insurance and litigation support, and food processing, all use scanning electron microscopy as a way to examine the surface composition of components and products.

c.Brightfield Microscope is used in several fields, from basic biology to understanding cell structures in cell Biology, Microbiology, Bacteriology to visualizing parasitic organisms in Parasitology. Most of the specimens to viewed are stained using special staining to enable visualization.

d.A dissecting microscope is used to view three-dimensional objects and larger specimens, with a maximum magnification of 100x. This type of microscope might be used to study external features on an object or to examine structures not easily mounted onto flat slides.
5 0
3 years ago
Cerebrospinal fluid (CSF) is formed by ________ and reabsorbed through arachnoid granulations into ________.
Ede4ka [16]
The correct terms to fill in the blanks are lateral ventricles and venous sinus blood. Cerebrospinal fluid (CSF) is formed by lateral ventricles and reabsorbed through arachnoid granulations into the venous sinus blood. The CSF is a fluid that is clear and colorless found in the spinal cord and in the brain, generally the central nervous system. The CSF functions as a buffer or a shock absorber for the brain. It provides basic mechanical protection for the brain. Also, it helps in the circulation of nutrients and the chemicals that are filtered and aids in the elimination of waste products. 
3 0
3 years ago
Answer friends , pls
maria [59]
6CO^2 + 6H2O—->sunlight C6H12O6+6O2
7 0
3 years ago
Throughout the history of nursing research, most studies have focused on clinical problems.
Tamiku [17]

Throughout the history of nursing research, most studies have focused on clinical problems. TRUE

7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • In most developing eudicot seeds, the primary source of nutritive material is in the ........
    12·2 answers
  • The function of beta-galactosidase is to ______.
    6·1 answer
  • Scientific explanations are evaluated by looking at new information and comparing it to older information to see if it is specif
    15·2 answers
  • How meiosis helps increase the genetic differences in babies?
    5·1 answer
  • Does anyone know the answer
    6·1 answer
  • Describe the structure of the cell membrane
    9·1 answer
  • In Drosophila melanogaster the recessive alleles for brown and scarlet eyes (of two independent genes) produce a novel phenotype
    12·1 answer
  • Non-potable water may contain __________.
    12·2 answers
  • It is not good for farmers to kill snakes. give reason​
    12·1 answer
  • Gentoo penguins present a potential mate with a pebble. Emperor penguins have a specific call and movement that they make to att
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!