1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
13

Solid substance A has a melting point of 100°C. Liquid substance B has a freezing point of 110°C. For each substance, identify i

ts state of matter and describe the motion of its particles when the substance is at 115°C.​
Biology
1 answer:
Liono4ka [1.6K]3 years ago
5 0

Answer:

Solid substance A has a melting point of 100 degrees Celsius. In this case, the substance is in the liquid state at 115 degrees Celsius. Liquid substance B has a freezing point of 110 degrees Celsius. In this case, once it reaches 115 degrees Celsius, the substance is still a liquid.

Hope it helped! <3

Explanation:

You might be interested in
What substance ,produce during photosynthesis ,provides food for plants and animals in a food web?
Leto [7]
I think the answer is glucose
6 0
3 years ago
Read 2 more answers
Explain why many plant parts appear green in color?
hammer [34]

Answer:

The chlorophyll inside the plants cells give the plants its pretty, green colour.

6 0
3 years ago
Read 2 more answers
What strand of mRNA would be produced from the strand of DNA shown below? ACT GAC
mel-nik [20]
The strand of mRNA = UGA CUG 
4 0
3 years ago
Read 2 more answers
Where do you find zooplankton
Brut [27]
Oceans, Seas, and bodies of fresh water 
8 0
3 years ago
A nurse is interacting with a depressed, suicidal client. what themes in the client's conversation are of most concern to the nu
Shalnov [3]
Loneliness and hopelessness
4 0
3 years ago
Other questions:
  • The
    15·1 answer
  • Are skin and/or bone an organ?
    6·1 answer
  • Biology question 3
    11·1 answer
  • In Pennsylvania, wolves have been extinct for many years. They used to feed on white-tailed deer, but not that the wolves are go
    13·1 answer
  • You could find ______ in sewage treatment plants.
    8·1 answer
  • Reasoning: Write a three sentence statement that connects your evidence to your claim
    13·1 answer
  • What is the difference between osmosis and diffusion?
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • You will need to think about your knowledge of particle theory to answer this question.
    12·1 answer
  • knockout of the circadian clock protein per1 exacerbates hypertension and increases kidney injury in dahl salt-sensitive rats
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!