1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
2 years ago
12

What's the eruptive style of composite volcano?

Biology
2 answers:
vova2212 [387]2 years ago
7 0
ANSWER:
Composite volcanoes are tall, steep cones that produce explosive eruptions. Shield volcanoes form very large, gently sloped mounds from effusive eruptions. Cinder cones are the smallest volcanoes and result from accumulation of many small fragments of ejected material. Volcanic eruptions may fall into six major types: Icelandic, Hawaiian, Strombolian, Vulcanian, Pelean, and Plinian.
DerKrebs [107]2 years ago
5 0

Answer:

Composite volcanoes are tall, steep cones that produce explosive eruptions.

Shield volcanoes form very large, gently sloped mounds from effusive eruptions.

Cinder cones are the smallest volcanoes and result from an accumulation of many small fragments of ejected material.

Explanation:

.......................

You might be interested in
Biofilms are accumulations of many different bacterial species adhering to some form of extracellular matrix. they often form as
lora16 [44]
They often respond to Quorum sensing which is determined by the cell density. Bacteria cells secrete molecules that can be detected by other bacteria, Quorum sensing allows bacteria to sense the concentration of these signalling molecules to monitor the local density of cells. It used by bacteria to coordinate certain behaviors , such as the production of biofilms. 
4 0
3 years ago
A collection of amoeba-like individuals that come together to form a large structure which can continue too movie is called a? A
snow_lady [41]
C(Water mold) i hope this helps

6 0
2 years ago
What are the likely effects of increasing greenhouse gas emissions on the ecosystem?
Studentka2010 [4]
Irreversible climate change and damage to marine and land life/humans.
5 0
3 years ago
Difference between Cellular and Humoral immunity?
Harrizon [31]

Cellular immunity kills pathogens inside the cell, whereas humoral immunity destroys pathogens outside the cell.

<h3>What is the difference between Cellular and Humoral immunity?</h3>

The main difference between humoral and cell-mediated immunity is that humoral immunity produces antigen-specific antibodies, whereas cell-mediated immunity does not produce antigen-specific antibodies. The cellular immunity destroys pathogens and harm microbes that are present inside the cell, whereas humoral immunity kills pathogens outside the cell.

So we can conclude that cellular immunity kills pathogens inside the cell, whereas humoral immunity destroys pathogens outside the cell.

Learn more about immunity here: brainly.com/question/6612564

#SPJ1

5 0
2 years ago
Which ingredients are needed to transform NADP+ to NADPH?
Gnesinka [82]

Answer: Two electrons and a hydrogen ion

Explanation: The light reactions use solar power to reduce NADP+ to NADPH by adding a pair of electrons along with a hydrogen nucleus, or H The light reactions also generate ATP by powering the addition of a phosphate group to ADP, a process called photophosphorylation.

6 0
2 years ago
Other questions:
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What can a good web best be classified as
    10·1 answer
  • Explain cancer in terms of the cell cycle
    15·1 answer
  • All objects anywhere on or near the Earth are
    15·2 answers
  • The process of _____ keeps the number of chromosomes constant from generation to generation
    14·1 answer
  • During which part of the cell cycle is the duplicated genetic material within the nucleus of a parent cell separated to creat tw
    9·1 answer
  • Which kind of biologist would most likely use satellite technology?
    6·2 answers
  • What are enzymes?<br> please help
    8·2 answers
  • Which statement describes a possible effect of climate change? Choose all that apply:
    8·1 answer
  • True or false: A cell's DNA is replicated during the M phase of the cell cycle.​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!