1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
2 years ago
6

Question 1

Biology
1 answer:
Akimi4 [234]2 years ago
8 0
Animal because the algae and plant would have to have chloroplast and the bacterium does not have a nucleus as it is a prokaryote.
You might be interested in
In which part of the nephron are sodium and chloride ions actively reabsorbed?
Eva8 [605]
The part of the nephron that In which part of the nephron are sodium and chloride ions are actively reabsorbed is the Henle's loop. It <span>is the portion of a </span>nephron<span> that leads from the </span>proximal convoluted tubule<span> to the </span>distal convoluted tubule<span>.</span> It's main function is to make a concentration gradient in the medulla of the kidney. 
3 0
3 years ago
What is one of the main differences between the phosphorus and sulfur cycles? A) Plants absorb phosphorus mainly from the air an
Elena L [17]
The answer is <span>D) The atmosphere has no significant role in the phosphorus cycle, but is an essential part of the sulfur cycle.

</span>

<span>Phosphorus is not abundant in the atmosphere. It comes mostly from the land and ocean. Phosphorus cycle through the lithosphere, hydrosphere, and biosphere, but not the atmosphere. The reason for this is that phosphorus cannot be found in the gas state, unlike the sulfur. On the other hand, sulfur cycle partially occurs in the atmosphere.</span>

8 0
3 years ago
Read 2 more answers
Is the virus considered a living creature? Justify the answer.
Stella [2.4K]

Answer:

Viruses are not living things.

Answer: No.

Explanation:

Viruses are complicated assemblies of molecules, including proteins, nucleic acids, lipids, and carbohydrates, but on their own they can do nothing until they enter a living cell. Without cells, viruses would not be able to multiply.

6 0
2 years ago
A new microbe has been discovered in the rumen of sheep. Microscopy shows no evidence of a nuclear membrane and biochemical stud
OLEGan [10]

Since it has no nucleus it's most likely a<u><em> prokaryote</em></u>

5 0
3 years ago
How does climate and vegetation vary with latitude and elevation?​
saw5 [17]

Answer:

Climate and vegetation vary with latitude and altitude of an area. Latitude measures distance from the equator; altitude measures elevation above sea level. ... Deserts have little precipitation and little vegetation. They are found in tropical, temperate, and Polar Regions.

5 0
2 years ago
Read 2 more answers
Other questions:
  • The ________ cell is interposed in the pathway between the photoreceptors and the ganglion cells.
    5·1 answer
  • IF<br> 21 - 4<br> 13 = 6<br> 23 = 12<br> 34 = 24<br> THEN<br> 25 = ?
    12·1 answer
  • Gene flow is one force that can cause evolutionary change. Which example best illustrates gene flow?
    10·1 answer
  • What would be the magnification of a specimen viewed with a compound light microscope that has an objective power of 40x and an
    6·2 answers
  • The internal processes of ___________ enables living things to survive changing conditions.
    10·1 answer
  • ___________ is a disease of newborns characterized by progressive under aeration of the lungs and a granular appearance.
    10·1 answer
  • How many ways are there for carbon to get transported to the atmosphere?
    15·1 answer
  • Homeostasis _____. occurs only at the cellular level is the maintenance of internal conditions is a process unique to eukaryotes
    12·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Muscles that produce movement in a single direction are
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!