During cellular respiration, carbon dioxide is released to the atmosphere during the formation of acetyl coenzyme A<span>. This step involves the oxidative decarboxylation of pyruvic acid, the result of which is carbon dioxide. This carbon dioxide is uptaken by plants and used in the process of photosynthesis to produce glucose.</span>
A divergent boundary plates moves away from each other.
HOPE THIS HELPS! ^_^
Answer: A - Rods are more numerous than cones
Explanation: Rods are found everywhere in the retina except the fovea (a tiny pocket in the retina where just about all of the cones are located).
B. The macula lutea is another word for fovea, no rods are found there.
C. Rods are utilized in low-light conditions and are not <em>sensitive</em> to wavelengths of light.
D. Cones are responsible for perceiving color and not rods.
E. The main function of the rods is to help us see in low-light conditions (scotopic vision), so this answer would be incorrect.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
