1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harrizon [31]
3 years ago
14

While many people new to the field of microbiology like to use the terms rods and spheres, you prefer the correct terminology th

at is currently in use to describe the morphology of bacteria, which is also utilized in naming newly discovered species of bacteria. Shape designations for the cells are based on Latin or Greek description of the cellular shape and configurations.
To aid anyone who will be reading this new introduction you are writing, you choose to develop a series of figures that will illustrate the multiple shapes and configurations that bacteria have evolved to use. Place the correct term next to the shape it denotes.

A. coccus
B. coccobacillus
C. bacillus
D. vibrio
E. spirillum
F. spirochete
G. pleomorphic
Biology
1 answer:
levacccp [35]3 years ago
8 0

Answer:

a

Explanation:

You might be interested in
What is eophrynus prestvicii?
Arada [10]
It is a prehistoric bug that is mostly closely related to the arachnids of today. I lacks a spinneret though. It is one of the first trigonotarbids to ever be described. (It looks like a spiky tick. Seriously) 
5 0
3 years ago
Read 2 more answers
The finger-like projections along the surface of the small instestines are called
Gnoma [55]
I think you may be talking about <span>VILLI.</span>
4 0
3 years ago
Plss helppp!!
irina [24]

Answer: I believe the answer would be C -- Changes observed in seismic wave data.

Explanation:

Geologists use rock samples as direct evidence about earth's layers, and they  use seismic waves as indirect evidence to study the Earth’s structure.

I hope this helps!

8 0
3 years ago
More than 200 different types of cells exist in the human body. Why do you think these cells are important for various body func
Doss [256]

Answer:

Different cells have different jobs to do. Each cell has a size and shape that is suited to its job. Cells that do the same job combine together to form body tissue, such as muscle, skin, or bone tissue. Groups of different types of cells make up the organs in your body, such as your heart, liver, or lungs

Explanation:

hope it helps you.

5 0
3 years ago
if a person throws a wiffle ball and a tennis ball at the same speed , which object would travel with more kinetic energy
devlian [24]

Answer:

Ithink the answer is tennis ball because the tennis ball is small.

5 0
3 years ago
Other questions:
  • How does the immune system work together with the circulatory system to function properly? A. The white blood cells of the immun
    11·1 answer
  • A substance placed in a container has a fixed volume and takes up the shape of the container. In which state does this substance
    11·2 answers
  • Which one of these is NOT a specialized area of science
    12·1 answer
  • Why the carbon dioxide in the biodome decreased?
    11·1 answer
  • The Calvin cycle happens during....
    6·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Will give brainliest! Write a couple sentences answering the question above! No copy and paste from internet
    14·1 answer
  • Identify which molecules the bag is permeable and impermeable to. Justify your answer.
    10·1 answer
  • The process where a virus takes a segment of DNA from one bacterial cell and inserts it in another bacterial cell is known as?
    11·2 answers
  • 1. why are pyruvates converted into acetyl-coa prior to entering the krebs cycle? what does this conversion do to the pyruvate m
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!