1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
topjm [15]
2 years ago
10

Beth wanted to buy vegetables. She noticed that brand A of black beans was on sale for 4 can for 87cents. Brand B was 3 cans for

79 cents. Which was a better buy
Mathematics
1 answer:
Aloiza [94]2 years ago
5 0

Answer:

Brand A

Step-by-step explanation:

If you divide both brands to find how much one can costs, brand B costs more per can.

79 ÷ 3 = 26.34

87 ÷ 4 = 21.75

That being said, if brand B were to sell 4 cans instead of 3 it would be more than brand A's 4 cans. Brand A is cheaper than brand B would be.

You might be interested in
Whats 1,234 in word form
yaroslaw [1]
1,234

One thousand
Two hundred
Thirty four
8 0
2 years ago
What is the Square root of -5
lilavasa [31]
The square root of -5

2.23606798

or

-2.23606798
8 0
2 years ago
Read 2 more answers
Select the correct number of solutions and description of the corresponding graph for two lines that have the same slope but dif
BaLLatris [955]

Answer:

c

Step-by-step explanation:

4 0
1 year ago
Read 2 more answers
There are three blue marvels and five red marvels in a bag you randomly select a marble and put it it back in the back if you do
olga nikolaevna [1]

Answer:

25 times

Explanation:

Blue Marvels: 3

Red Marvels: 5

Total Marvels: 5 + 3 = 8 marvels

Probability: favorable outcomes/total outcomes

Probability - red marble =  5/8

After Doing 40 times:

= 5/8 × 40

= 25

7 0
1 year ago
I need 33. B) find the exact time when the radius reaches 10 inches<br><br> 100 points! Plz help
stealth61 [152]

Step-by-step explanation:

You have found a function r(V(t)). We can see that this function is a one variable function. The variable is time.

So in this specific function we can call r(v(t)), r(t).

So:

r(t) =  \sqrt[3]{ \frac{3 \times (10 + 20t)}{4\pi} }

If α is the moment that the radius is 10 inches and since the function above gives radius in inches we have to solve the equation:

r( \alpha ) = 10

Which is the same as:

\sqrt[3]{ \frac{3 \times (10 + 20 \alpha )}{4\pi} }  = 10 \\  \frac{3 \times (10 + 20 \alpha )}{4\pi}  = 1000 \\ (10 + 20 \alpha ) =  \frac{4000\pi}{3}  \\ 20 \alpha  =  \frac{(4000\pi - 30)}{3} \\  \alpha  =  \frac{(4000\pi - 30)}{60}

3 0
2 years ago
Other questions:
  • Subtracting Fractions.<br><br> Fill in the blanks, and the tenth one is 4 2/3 + 7 7/10=
    7·1 answer
  • "a guest orders a drink that contains 1½ ounces of 80-proof vodka and 12 ounces of beer. approximately how many drinks does this
    13·2 answers
  • !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    9·1 answer
  • How do I do this problem? Evaluate each expression <br> (-4)-(-6)-(2-1)
    14·1 answer
  • a sleeping bag weighs 8 pounds. your backpack and sleeping bag together weigh 31 pounds. write an equation to determine whether
    10·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • A large rectangular shaped aquarium has a volume of 300 ft3. If the aquarium has a height of 3 feet and a length of four more fe
    5·1 answer
  • La casa de prestamos la mejor cobra el 7% de interes mensual.Es decir por cda 100 paga solo 7 pesos
    13·1 answer
  • At Picture Perfect Pizza the price for 2 slices of pizza is $3.00. At Pizza Outpost
    7·1 answer
  • Using small pieces of construction paper, Sara makes a collage in the shape of a circle for art class. The diameter of the colla
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!