1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-Dominant- [34]
3 years ago
6

What is the most appropriate way to present the data below?

Biology
2 answers:
ziro4ka [17]3 years ago
7 0

Answer:

bar graph it is little difficult but it will be most appropriate way to present the data thank you

Explanation:

mark as a brainlist

Lady_Fox [76]3 years ago
6 0
A line graph. It is a graph of progression of weeks so it will need a line of best fit. AND PLS MARK ME BRAINLIEST. HAVE A GREAT LIFE AHEAD!
You might be interested in
Por que se dice que los seres vivos son considerados sistema
Doss [256]

Answer:

La energía del organismo vivo no se puede perder ni ganar del entorno externo.

Explanation:

6 0
3 years ago
How are rocks formed?<br><br> igneaus sedimentary metamorphic
Nitella [24]

Answer: Due to rise in temperature and pressure

Explanation: Rocks are formed due to rise in temperature and pressure. It involves larger rock masses. The main rock types are gneisses and schists which have a laminated banded appearance.

8 0
1 year ago
Explaining of matter when it is heated known as
Stella [2.4K]

When heat is added to a substance, the molecules and atoms vibrate faster. As atoms vibrate faster, the space between atoms increases. The motion and spacing of the particles determines the state of matter of the substance. ... Solids, liquids and gases all expand when heat is added.  Matter can change from one state to another when thermal energy is absorbed or released. ... heated, it absorbs thermal energy and its temperature rises. At some point, the temperature stops rising and the ice begins to change into liquid water. The change from the solid state to the liquid state is called melting.

8 0
3 years ago
Read 2 more answers
This question is for zoology
musickatia [10]

Answer:

Explanation:

All Cnidarians have appendages with stinging cells in their tips which are utilized to capture and stifle prey. In truth, the phylum title "Cnidarian" actually implies "stinging animal." The stinging cells are called cnidocytes and contain a structure called a nematocyst. The nematocyst could be a coiled thread-like stinger.

6 0
2 years ago
The characteristics associated with the development of the organs and structures of the body that directly relate to reproductio
alisha [4.7K]

Answer: Primary Sex characters

Explanation:

The primary sexual characters are associated with the growth of sexual organs such as uterus, vagina, penis and other reproductive organs in the human beings.

These organs are present in the body when the child is borne. This is because they grow when the child is inside the womb.

The development and maturation of these organs takes place during the later stages of life.

3 0
3 years ago
Other questions:
  • Scientists have been experimenting with gene therapy which often involves the use of bacteria or viruses to deliver new or modif
    14·1 answer
  • What change occurred in the atmosphere 2.5 billion years ago
    9·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • DNA provides the _______ necessary to take a bunch of lifeless chemicals and turn them into ___________________.
    5·1 answer
  • at which location does gravity play a role in moving tectonic plates? at the edge of the plates. in the core. in the mantle. in
    8·1 answer
  • Vocab.
    13·2 answers
  • What does the fox say
    11·2 answers
  • Why is DNA more accurate than examining physical traits in determining evolutionary relationships? Is there any case in which ph
    5·2 answers
  • What is the most significant difference in current weather forecasting methods compared to what was done in the past?
    10·2 answers
  • How are meiosis and mitosis similar?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!