1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
2 years ago
5

Tori experiments with pulleys in physics class. She applies 70 newtons of force to a single pulley to lift a bowling ball. By ad

ding another pulley, she’d get a mechanical advantage of 2. What’s the minimum input force she’ll need to lift the ball if she adds another pulley?
A.
2 N
B.
35 N
C.
68 N
D.
70 N
E.
140 N
Biology
2 answers:
Norma-Jean [14]2 years ago
4 0
I think the answer is b
skad [1K]2 years ago
3 0
I think B is the most likely answer
You might be interested in
At which point are the doldrums located
dsp73

Answer:

The doldrums are commonly found around the equator. The doldrums are an area characterized by calm monotonous weather.  

8 0
3 years ago
When a comet gets near the Sun, it starts to melt, leaving behind small pieces. What happens when the Earth moves through a come
Dahasolnce [82]

Answer:

c the comet turns into a shooting star and is gone forever

5 0
2 years ago
Please help ASAP!!!!
Svetllana [295]

Answer:

ight bet

Explanation:

3 0
2 years ago
Human muscles have an efficiency of about
ira [324]
The answer will be c
7 0
2 years ago
Discuss the effects of binary fission and short generation time on the accumulation of mutations in a bacterial population over
scZoUnD [109]

Due to the <u>mutation </u>accumulation, the <u>binary fission</u> in bacterial population will decrease due to in ability to divide (Due to inactive replicating enzymes). In the similar way, the <u>generation time</u> will also decrease.

Binary Fission- Binary fission, also known as asexual body division into two new bodies, When an organism divides into two halves (cytokinesis) by binary fission, it doubles its genetic material, or DNA, with each new creature acquiring one copy of the latter.

Generation Time- The amount of time it takes for a colony of bacteria to double in size is known as the generation time. The generation period for various bacteria ranges from a few minutes to many hours. Bacteria multiply by geometric progression because of binary fission.

To know more Mutation, click on the below link,

brainly.com/question/13923224

#SPJ4

6 0
1 year ago
Other questions:
  • Which group of Protist does the Ameoba belong to?
    12·1 answer
  • Meiosis produces..?<br> A.) gametes<br> B.) somatic cells<br> C.) body cells<br> D.) mitotic cells
    13·2 answers
  • What is true of carbon atoms? (2 points)
    7·1 answer
  • What temperature would a pond be in winter in florida
    7·1 answer
  • A child pours water down a hill. What energy transformations occur in the water?
    12·1 answer
  • Two identical wires are both carrying the same amount of current flowing in opposite directions.when these wires are brought clo
    14·2 answers
  • In the western U.S., ranchers aggressively killed wolves because they posed a threat to their cattle. As the wolf population dec
    11·1 answer
  • The diagram shown represents a pair of homologous autosomes. The letters B and b represents genes for a certain trait. These let
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • I Will DEEM BRAINLIEST!!!!! What problem did run into the most when you tested your prototypes? What did you do to fix this prob
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!