1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
2 years ago
14

What's another name for vitamin E​

Biology
2 answers:
Monica [59]2 years ago
6 0

Answer:

tocopherol or alpha tocopherol

diamong [38]2 years ago
5 0

Answer:

tocopherol or alpha-tocopherol

Explanation:

Source: https://medlineplus.gov/lab-tests/vitamin-e-tocopherol-test/

Hope this helps ! :)

pls mark brainiest

You might be interested in
Mitral valve prolapse severe enough to cause regurgitation may directly cause _________________ pressure in the ____________ atr
GenaCL600 [577]
Mitral valve prolapse severe enough to cause regurgitation may directly cause INCREASE pressure in the LEFT atrium. Mitral valve prolapse is a medical condition in which the the two valve flaps of the mitral valve do not close properly, bulging upward into the left atrium. The condition may be mild or severe. Heart surgery may be required in case of the severe one.
7 0
3 years ago
What way do water molecules move when a egg is placed in the water
krok68 [10]

Answer: It has a lower concentration of water (25% water) than the egg (90% water). To reach equilibrium, osmosis causes the water molecules to move out of the egg and into the corn syrup until both solutions have the same concentration of water. The outward movement of water causes the egg to shrivel.

Explanation:

5 0
3 years ago
Is genetic engineering a good idea? I need details in the answers :) 20 points answer. $$$$$
TEA [102]
I think that genetic engineering is a good idea because it helps cure deseases that people cant cure, and could possibly cure cancer some day. 
Hope my oppinion helped!
5 0
3 years ago
Read 2 more answers
Biology - year 8 Hey pls help me with the questions below
tatiyna

Answer:

1. plant use sunlight , carbon dioxide,water. 2. Gulcose and oxygen

4.a)xylem b)phloem

6.leaves

8.roots,stems,flowers,leaves

4 0
3 years ago
5. Which statement below is not true about the DNA found in sperm and egg cells?
pashok25 [27]

The answer is d. they are identical

5 0
3 years ago
Other questions:
  • Asexual reproduction is not as widespread in (plants, animals) as it is in (plants,animals) .
    9·2 answers
  • What surprised Mendel about his F1 generation plants?
    13·1 answer
  • What are the three homologies in living organisms
    6·1 answer
  • A frog lays thousands of eggs because many eggs die. This behavior is an example of. a. Competition. b. over production. c. veri
    7·1 answer
  • What way did ancient people classify plants and animals
    8·1 answer
  • People are likely to detect male prejudice against females ________ easily than they detect female prejudice against males. they
    11·1 answer
  • How does the chemical equation for cellular respiration compare The one for photosynthesis
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Can someone please explain how three of the leaf structure functions to help the plant with the life process of photosynthesis a
    11·1 answer
  • Why does aquaporin (aqua1) transport h2o orders of magnitude faster across the erythrocyte plasma membrane than glut1 transports
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!