1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pshichka [43]
3 years ago
7

Photosynthesis and Cellular Respiration: Are They Similar?

Biology
2 answers:
Korvikt [17]3 years ago
7 0

Answer:

The two processes are similar in that they both produce energy, albeit in two different forms. ... The win-win of the two processes is that they both provide each other with the necessary ingredients for the process to take place: glucose and oxygen for cellular respiration, carbon dioxide and water for photosynthesis.

Explanation:

konstantin123 [22]3 years ago
5 0
They are quite similar but the difference is that photosynthesis converts carbon dioxide and water into oxygen and glucose, but cellular respiration converts oxygen and glucose into water and carbon dioxide. Basically they just do the opposite things.
You might be interested in
Maintaining homeostasis keeps the internal environment in the body functioning properly. Many organ systems work together and ma
Varvara68 [4.7K]

Answer:

D

Explanation:

However, the organ systems also work together to help the body maintain homeostasis. For example, the cardiovascular, urinary, and lymphatic systems all help the body control water balance. The cardiovascular and lymphatic systems transport fluids throughout the body and help sense both solute and water levels and regulate pressure.

4 0
3 years ago
[BWS.02]Which of these questions can be answered through science?
GREYUIT [131]

Answer:

Is wood heavier than paper

Explanation:

This is the only question that can have a definite answer and not an opinionated response

5 0
3 years ago
Read 2 more answers
Which type of molecule makes up DNA?<br> Lipid<br> Nucleic acid<br> Protein<br> Water
kvasek [131]

What type of molecule makes up DNA?

B. Nucleic Acid

5 0
3 years ago
Read 2 more answers
Asexual reproduction in the parent cell will result in offspring with
alukav5142 [94]
The correct answer is
 offspring

8 0
4 years ago
Read 2 more answers
Which one is organ????
Flauer [41]
I think is the letter, S
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which structure within a bone contains cartilage cells that divide and increase the size of the bone until adulthood? 
    13·1 answer
  • Match the description on the right with the force on the left.
    8·1 answer
  • How is growth different from reproduction​
    9·2 answers
  • In DNA, the nitrogen bases pair up. The correct pairing is __________ with _________, and ________ with _________. *
    12·1 answer
  • What are the three types of RNA?
    14·2 answers
  • Economic importance of grasshopper
    14·2 answers
  • What is music? in own words lol
    14·1 answer
  • Answer first and correct for brainly
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • In your own words, explain what happens in the water cycle
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!