1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Deffense [45]
3 years ago
12

which of the following structures allow the cell membrane to be selectively permeable? select all that apply.

Biology
1 answer:
11111nata11111 [884]3 years ago
7 0
Hospolipid bilayer, with some protein, is what makes the cell membrane selectively permeable.
You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
How is dna the basic of life?
Allushta [10]


DNA is considered the molecule of life because it contains the instructions that ensure the continuity of life. Employment of DNA to code for protein is the basis of all life on earth. 

In all living things, inherited DNA  is used to code for amino acids  which when joined or linked together in a deliberate specific  manner form polypeptides which make up proteins. These proteins are responsible for  structure and function of cells. 

For example DNA provides information to make  four polypeptide (two beta and two alpha ) chains  which make up hemoglobin, the protein that functions as the oxygen carrier in red blood cells. In summary,

DNA → protein →  trait, and that relationship is the physical basis of life.


6 0
3 years ago
Sperm cells get energy to power their movement from __________, which is contributed by the __________.
777dan777 [17]
Fructose; seminal vesicles


3 0
3 years ago
When salt is dissolved in water water is the <br><br> Solution<br> Solvent<br> Solute
kipiarov [429]
Water is the solvent
4 0
3 years ago
What state of matter is this
Tasya [4]

pls tell me that which state of matter

5 0
3 years ago
Other questions:
  • Which of the following is NOT an impact of wildfires? (Notice it says NOT)
    11·1 answer
  • Mature trna has an amino acid binding site at one end and the other end interacts with the mrna by complementary base pairing du
    15·1 answer
  • A protein biochemist attempted to determine the amino acid sequence of a decapeptide. Use the results from the trypsin, chymotry
    13·1 answer
  • Hayvan hücresinde selüloz sentezleyen organel hangisidir?
    9·2 answers
  • Explain how genetic modifications impact crop yield. How will this help feed the world in 2050?
    14·1 answer
  • Please help.
    11·2 answers
  • Describe how the process of natural selection can cause an increase in how
    6·1 answer
  • ________ thousands of tiny projections that add even more surface area to villi​
    8·1 answer
  • Is sample M most likely to be chicken, rice, a mango, or butter?
    8·1 answer
  • In the greenhouse effect, far infrared radiation is blank Earth's surface and absorbed and reemitted by blank gases in the atmos
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!