The answer is 7.4%.
Percentage of trucks on the lot is equal to the ratio between the number of trucks and the total number of cars.
- Number of trucks ÷ Total number of cars
- 49 ÷ (49 + 612)
- 49 ÷ 661
- 7.4%
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Its where one plate moves under another and is forced or sinks due to gravity into the mantle. This is where you get your sinkholes from.
Answer:
The CFTR behaves like a channel for chlorine. Its dysfunction affects both the transport of this ion and other ions and the transport of water, which causes a thickening of secretions, an alteration of mucociliary transport and local defenses, facilitating bacterial colonization and promoting the release of pro-inflammatory mediators in the airway
Explanation:
CFTR is a protein expressed in the epithelial cells of the respiratory system, pancreas, bile ducts, sweat glands and genitourinary system. It is made up of a single chain made up of 1,480 amino acids. It contains 12 hydrophobic regions embedded in the lipid membrane and acts as a channel for chlorine.The highest levels of expression of the CFTR protein are found in serous cells of the submucosal glands of the proximal airway. In them, Cl- is released to the outside. In addition, there are channels for Na +, through which this ion is also secreted in the same direction. These movements cause the displacement of water and also of mucins, originating in the submucosal glands, allowing their presence on the surface of the airway. For all this to occur normally, a basolateral Na + - K + - ATPase cotransporter must function, another basolateral cotransporter formed by Na +, K + and 2 Cl-, which allows the latter to enter the cell, and an apical CFTR channel through which it exits the Cl- of the cell towards the acinar lumen. Na + leaves the cell following Cl- by a paracellular pathway accompanied by water. When CFTR malfunctions, Cl- does not exit through this channel and this implies a decrease in Na + and water in the canalicular lumen, with the consequent thickening of secretions.
