1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka-Z-Leto [24]
3 years ago
9

What Type: of cells go through the special cell division process of meiosis?

Biology
1 answer:
kolezko [41]3 years ago
3 0
<h2>Check the Attachment!!!!!</h2>

You might be interested in
Need help on checking my answers! The ones circled in yellow are the ones that I believe the answers are. Please and thank you (
ollegr [7]
Not sure so dont quote me on this but i believe it is producers and consumer.
4 0
3 years ago
You are a new hire at a bioinformatics company and are helping to annotate the genome of a recently sequenced organism. A co-wor
Vera_Pavlovna [14]

Answer:

A protein-coding gene has an open reading frame (ORF) that make easier its identification

Explanation:

During translation, the messenger RNA (mRNA) is read by the ribosomes as triplets of nucleotides called codons in the open reading frame (ORF). An ORF can be defined as a gene fragment composed of codons which are translated into amino acids in a polypeptide chain. According to the genetic code, the information encoded by these codons will specify the sequence of amino acids in the protein, as well as the start codon and stop codons of the protein-coding genes. A start codon (AUG) is a site at which translation into protein begins, while stop codons (UAA, UAG, and UGA) mark the site at which translation ends. Moreover, non-coding RNAs (ncRNAs) don't have ORFs because they do not encode for proteins, and therefore their identification is more difficult.

8 0
3 years ago
Which is not a deciduous tree
irakobra [83]
Non deciduous are evergreen trees or Shade trees are not deciduous trees. evergreen plant leaves last throughout the year.
for example a pine tree or cedar plant would be considered non deciduous because they keep leaves\ last throughout the year.
7 0
3 years ago
A deficiency of which molecule will trigger lactic acid buildup in our muscles? ATP Carbon dioxide Oxygen Water
ValentinkaMS [17]
Oxygen, neccessary for cellular respiration, is the answer. As oxygen becomes scarce, your cells begin to aerobically produce very little ATP, in effect fermenting and producing lactic acid.
5 0
3 years ago
Read 2 more answers
Natata Townsend
attashe74 [19]

Answer:

B

Explanation:

the nutrient that is required for repairing cells is protein

5 0
3 years ago
Other questions:
  • What role does the Automated Surface Observing Systems (ASOS) play in weather forecasting?
    13·2 answers
  • Membrane potential is determined by the: number and type of phospholipids present in a membrane. concentration of cholesterol in
    5·1 answer
  • Ice floats in water because it _____.
    5·2 answers
  • Explain how a plant obtains usable energy through the process of photosynthesis.
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which systems work together so oxygen can be distributed to the cells of your body. How do these to systems work together to acc
    9·1 answer
  • Which of these statements is correct about a theory?
    15·2 answers
  • The process by which the number of chromosomes is reduced by half is sex cells is called what
    13·1 answer
  • A student helps his teacher lift a 200 N box of books 1.2 m from the floor to the desktop. In which of the following situations
    5·1 answer
  • Which of the following is an example
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!