1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
3 years ago
15

Write a paragraph that describes where DNA is found inside cells and how it is packaged.

Biology
1 answer:
Anna35 [415]3 years ago
8 0

Answer:

DNA is tightly packed up to fit in the nucleus of every cell. A DNA molecule wraps around histone proteins to form tight loops called nucleosomes. These nucleosomes coil and stack together to form fibers called chromatin.

Explanation:

No explanation needed.

You might be interested in
What role does the capsid play in viral reproduction? (1 point)
Oduvanchick [21]
  • \text{ The capsid copies the host cell’s DNA}

Explanation:

\sf{ }

The capsid copies the host cell’s DNA is the role of the capsid play in viral reproduction.

5 0
3 years ago
Scientists use restriction ________ to
Alexus [3.1K]

Answer: enzymes (B)

Explanation: just took the quiz on usa test prep!

6 0
3 years ago
Which statement forms part of cell theory​
sineoko [7]
The cell theory follows :
Cells are the basic unit of life
All living things are composed of cells
All cells are reproduced from other cells

Hope this helps:)




~ His Cookie Monster
7 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Why are symbiotic relationships important in an ecosystem?
Gemiola [76]

Answer:

Information:Symbiotic relationships are important because they are a major driving force of evolution. This networking and cooperation among species allows them to survive better than they would as individuals.

6 0
3 years ago
Other questions:
  • What is the nucleolus and where is it found
    15·1 answer
  • An adult normal range of 60 to 85 mm hg is the standard for which blood pressure measurement?
    9·1 answer
  • Que es un eucariota
    14·2 answers
  • Write a complete step-by-step plan for dealing with broken glassware on the floor or lab table. Write your plan in list form in
    6·2 answers
  • A biological membrane is selectively permeable in that it can, to some extent,control which substances pass through it. Based on
    7·1 answer
  • What are the subunits of nucleic acids?
    11·1 answer
  • What is most important about Earth's atmosphere? A. It always makes airplane rides smooth. B. It makes beautiful sunsets. C. Wit
    5·2 answers
  • During which two phases of the moon do neap tides take place?
    6·1 answer
  • What are the correct answers?
    8·1 answer
  • Which question, when answered with "yes", indicates that a behavior is an instinct?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!