All categories

3 years ago

(Please HELP, although its very long, its due today so 100 POINTS!!)

Biology

1 answer:

Lesechka [4]3 years ago

5 0

Answer:

How do nutrients move through an environment? What drives the movement of nutrients?

My answer 6b: Nutrients are often transported across the environment by migrating from the physical environment into living creatures and then being recycled back into the physical environment. For example, an animal could receive nutrition by eating plants. To stay alive, the animal uses the chemical energy gained from the food. When the animal dies, the nutrients in its body return to the soil and are re-absorbed by plants. The transport of nutrients in the ecosystem is driven by nutrient cycles.

You might be interested in

Carbon atoms can form (2 points):

Jlenok [28]

Answer:

C. four single covalent bonds

Explanation:

Carbon atoms can form four single covalent bonds.

6 0

3 years ago

Read 2 more answers

How long would it take to walk 700 miles?

zaharov [31]

It would takes around 175 hours to walk 700 miles.

4 0

3 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

3 years ago

(a) Describe why monitoring the growth rate of the E. Coli-M bacteria is a useful indicator of the effect of the glycolytic enzy

netineya [11]

Answer:

The monitoring the growth rate of E.Coli bacteria is a useful indicator of the effect of glycotic enzyme mutation on the bacteria as the flow of intracellular metabolic components depends on the availability of carbon. Hence the change in carbon source can change the glyclyotic enzyme mutation up or down.

Explanation:

Continuous culture is a method that can be used by the researchers for determining whether mutation affects the growth rate of E.Colin-M bacteria

If the growth medium contains higher concentration of acetate,then the growth of the bacteria will be inhibited without inhibiting its central metabolism.

When E.Coli grows ,it secrets acetate. This mechanism is called overflow mechanism. Regulatory interactions mediated by acetyl-phosphate plays a major role in inhibiting growth by acetate. The uncoupling effect of organic acids or perturbation of the anion composition of the cell is a major reason for growth inhibition.

8 0

3 years ago

The zebra mussel is an invasive species. Which statement is most likely true if the zebra mussel is introduced to a new environm

crimeas [40]

Answer:

Explanation:

when given that a species is <em>invasive</em> you can read through the answers and determine which description sounds invasive

7 0

3 years ago