1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
2 years ago
9

_____ - is the study of how things work; gathering new information, new investigations.

Biology
1 answer:
ruslelena [56]2 years ago
6 0

Answer:

science

Explanation:

You might be interested in
Michael took a swab of bacteria from a Petri dish and placed it on a glass slide. Then he treated the sample with a series of dy
pogonyaev
Compound microscope/compound light microscope

they’re the same thing
7 0
3 years ago
Read 2 more answers
The units of geologic time from largest to smallest?
LiRa [457]
Idk the timeline but from largest to smallest, this hierarchy includes eons, eras, periods, epochs, and ages.
7 0
3 years ago
Drag each label to the correct location. Match the food item to its nutrient group.
Rus_ich [418]

I am assuming you mean the nutrient groups of macronutrients and micronutrients.


Macronutrients:

<em>fats</em>

<em>carbohydrates</em>


Micronutrients:

<em>calcium </em>

<em>zinc</em>

<em>vitamins</em>

Hope this helped :)


7 0
3 years ago
Read 2 more answers
What are the three main zones of the open ocean?
klasskru [66]
The 3 zones are t<span>he surface zone, the transition zone, and the deep zone.</span>
4 0
4 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Other questions:
  • What I'd the difference between transpiration and guttation
    11·1 answer
  • Earth’s mantle is made of a dense thick material that allows movement of crustal plates. Crustal plate movement occurs because t
    14·2 answers
  • What are the 3 substances which are reabsorbed from the nephron in the blood?
    9·1 answer
  • What is not a necessity of life?
    9·1 answer
  • Which are two ways a population can decrease in size?
    9·1 answer
  • When both alleles are the same the individual is what for that trait
    13·1 answer
  • Cuanto dedos hay en el ser humano
    7·1 answer
  • A student was studying osmosis. She performed an investigation in which she soaked sample cells in a sucrose solution. She weigh
    11·1 answer
  • This is a test for my<br> brainly plus
    15·1 answer
  • If phosphorous has 5 valence electrons, how many does sulfur have?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!