1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
2 years ago
10

A type of agriculture in which the farmers focus on growing enough food to feed

Biology
1 answer:
hammer [34]2 years ago
7 0

Answer:

subsistence agriculture

Explanation:

The land is limited, cultivation systems are basic, and there is not enough harvest to sell.

You might be interested in
If a muscle contracts isometrically for a long period of time, an EMG (which records the electrical activity in the muscle) reco
oksian1 [2.3K]

Answer:

During the course of a continuous isometric contraction of given strength, the electrical activity progressively increases. This is due to recruitment of motor units taking place to compensate the decrease in force of contraction occurring in the fatigued muscle fibres.

Explanation:

5 0
3 years ago
A scientist at a chemical company designs and conducts an experiment to determine if a chemical made by the company is harmful t
Olegator [25]
The scientist is being B. unethical
7 0
3 years ago
Read 2 more answers
Why are bacteria required in the nitrogen cycle?
MrRissso [65]
<span>Bacteria is needed to convert nitrogen gas/ammonia into nitrates for "enhancing" the growth of plants.</span>
6 0
3 years ago
Sperm whales, a(n) species, maintain their populations close to carrying capacity.
soldier1979 [14.2K]
The answer is K-selected.

<span>The population size of K-selected species is fairly constant in time, unlike the population size of r-selected species. r-selected species are usually bellow carrying capacity and the population size is density independent. On the contrary, K-selected species are usually near or at carrying capacity and the population size is density dependent. It can be concluded that sperm whales have K-selected populations, since they </span><span>maintain their populations close to carrying capacity.</span>

4 0
3 years ago
Read 2 more answers
Plz plz. Base your answer on the diagram below and on your knowledge of biology. The diagram illustrates one possible scheme of
DENIUS [597]

Molluskcea and Annelida. The answer is C

4 0
3 years ago
Other questions:
  • Predict the chemical formula of butyne, having one carbon-carbon triple bond. A. C4H8 B. C4H10 C. C4H6
    8·2 answers
  • The excretory system helps the respiratory system by
    9·1 answer
  • SaturatedUnsaturated fats remain in liquid form at room temperature
    10·1 answer
  • Methylation and subsequent deamination of cytosine produces what type of mutation after one round of DNA replication? Methylatio
    10·1 answer
  • Which chemcal bond most likely stores the most energy?
    11·1 answer
  • List 3 negative impacts that overpopulation can have on a population!!
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The environment protection agency was assigned which task
    5·1 answer
  • DNA and RNA differ in all BUT one of the following ways.
    7·1 answer
  • Which statement best describes how Watson and Crick's model used other scientists' work to create a model of DNA?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!