1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
densk [106]
2 years ago
5

Quién me ayudaría a hacer este crusigramagracias ​

Biology
2 answers:
Sliva [168]2 years ago
8 0

Answer:

Respuesta: hola ami me parece que ya lo hiciste pero te dejo ejemplos:

Explicación: 1.Venezuela

2. Sanclemente

3. Marroquin    

me das corona plis chau

Explanation:

diamong [38]2 years ago
3 0

Answer: B i think

Explanation:

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
_____ are within the inner membrane of the mitochondria and increase its ability to create ATP.
iVinArrow [24]
Matrix are within the inner membrane of the mitochondria.
7 0
3 years ago
I am made of glyercol and fatty acid
Komok [63]

This is most definitely the definition for a Lipid!

3 0
2 years ago
Read 2 more answers
Statement
skelet666 [1.2K]
The answer to your question is true
8 0
2 years ago
Indicate the phenotypic ratio of crossing the offspring of the agouti and chinchilla.
devlian [24]

Answer:

Option A is correct.

Explanation:

Phenotype ratio is the number of one phenotype compared to another phenotype.( physical characteristics)

C/cch * C/c

4 0
3 years ago
Other questions:
  • As a character of all living things, homeostasis relates most directly to which of the following biological themes
    9·1 answer
  • Drug users body grow taller to the moon and back and the side effects of the drug aposome rate
    15·1 answer
  • I need help with this question
    12·1 answer
  • (100 POINTS WOAHHHHH AND BRAINLYEST odfssk) Fossils that can be used to date rocks are known as index fossils. They have a speci
    8·2 answers
  • When the insulin molecule is folded where do you find leucine and isoleucine? Where do you find arginine and glutamate?
    15·1 answer
  • What type of data does an an EKG AND ITS importance in understanding the health of the heart.
    5·1 answer
  • 15 points for this! Thank You
    13·1 answer
  • Which of the following is most likely to be an energy source for the cells of a living thing?
    8·1 answer
  • Many plants can reproduce both sexually and asexually. For example, rose bushes reproduce asexually when cuttings planted in the
    13·1 answer
  • How “Competition in an ecosystem” is playing a role in life?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!