1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kakasveta [241]
3 years ago
6

what are the similarities and differences between moraine and outwash? ( more than one similarities and differences ) please hel

p​
Geography
1 answer:
sineoko [7]3 years ago
5 0

Answer:

An interlobate moraine is a moraine built between two adjacent lobes of a glacier. Outwash may be intermingled with morainal landforms due to local glacial re-advances. There may be deposition of till during glacial advance followed by outwash deposition upon retreat, or vice versa.

Moraine: an accumulation of till deposited by direct glacial action. ... Outwash may be intermingled with morainal landforms due to local glacial re-advances. There may be deposition of till during glacial advance followed by outwash deposition upon retreat, or vice versa.

You might be interested in
Explain why people still live in the shadow of volcanoes. [4 marks]
Sveta_85 [38]

Answer:

People live close to volcanoes because Geothermal energy can be harnessed by using the steam from underground which has been heated by the Earth's magma.Apart from the volcano itself, hot springs and geysers can also bring in the tourists. This creates many jobs for people in the tourism industry.

8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
WILL MARK BRAINLIEST! <br> What are three examples of Human geography of Utah?
Basile [38]
Landform
Climate and weather
Natural hazard
8 0
3 years ago
Which statement is true about
ss7ja [257]
C
The houses are made to last for centuries
3 0
2 years ago
Read 2 more answers
Match the measuring instrument with the appropriate statement.
dexar [7]
1. Tiltmeter matches with <span>"The _____ suggests that the ground has risen about 2 inches." 

2. </span><span>Richter scale:  </span>"People in the cafeteria felt the quake, but those in the conference room didn't. The earthquake magnitude must've been around 3 on the _____." 
<span>
3. </span>Mercalli intensity scale: <span>"If you want to measure the earthquake based on the level of damage incurred, use the _____." 

4. S</span>eismograph: <span>"The _____ records P waves first, then S waves." 

5. C</span>orrelation Spectrometer (COSPEC): "Look! That volcano is emitting smoke! Grab your _____ and measure the sulfur dioxide content." 

6. Moment Magnitude Scale: <span>"I would use a _____ to measure the magnitude of earthquakes that occur over large areas." </span>
8 0
3 years ago
Other questions:
  • Earth's biosphere does not depend on earth's atmosphere true or false?
    10·1 answer
  • Put the following in order from earliest to latest formation
    7·2 answers
  • At which fo the following locations would you be most likely to find a high population density
    12·1 answer
  • What is the gravitational singularity known as the Big Bang?
    7·1 answer
  • Why does the ocean water become salty at the north pole?
    8·2 answers
  • Question 5 of 15
    10·1 answer
  • Give and describe the 3 most common chemicals mixed with water.
    11·1 answer
  • The example above describes the process that generates many surface winds. Surface winds are an example of _______ in the Earth'
    9·1 answer
  • The table shows the brightness of some stars when viewed from Earth. The brighter a star appears from Earth, the lower its appar
    13·2 answers
  • How many years are between 1389 ce and 479 bce
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!